Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FCTEVCP	FCTEVCPM034_F02_PDNR-F	1046

Contig Map:

(ProjectName=FCTEVCP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FCTEVCPM034_F02_PDNR-F](Singleton Sequence)

FCTEVCPM034_F02_PDNR-F 1046  bases 
GGACAATTCCACGCTTCCTCTGGCCCGCAGCATTCAATTCATCTTCTCAGTTCGTCTTCAACAAAGAAGATTGGCCTCCAGTTCTCTTCTCTCGTGTGAAAACTCAAGGCGAGGAAAGTTAGATGAATAGCTTCAGATAAAGCTTTACAAAAGCAGCCGAAAGAAGGAGGGCGAGAAAGGAAGGAGCTTGTAGAAGGGAGGTATGGAGCCGGGGTCTGCATCTAGCGAGGGGCAGATAAAGGGGGTTCTCACTCATGGCGGCAGGTATGTGCAGTACAATGTTTACGGTAACTTATTTGAGGTCTCCACCAAATACGTTCCCCCCTTGCGGCCTGTGGGCCGAGGTGCCTATGGCATTGTCTGCGCTGCAGTGAATTCACAGACACGTGAAGAGGTTGCCATTAAGAAGATTGGCAATGCATTTGACAATAGAGTTGATGCGAAGAGAACTTTAAGAGAAATAATGCTTCTTCGTCATTTGAATCATGAAAATATAATTGGTATCAAGGATATCATCCGCCCTCCGAAAAGGGAAACTTTTAATGATGTCTATATTGTTTATGAACTGATGGAGACAGATCTTCATCAAATTATTCGCTCCAACCAGCCTCTAAATGATGATCATTGTCAGTTTTTCCTCTATCAGCTACTAAGGGGTCTAAAATACGTGCACTCTGCGCATGTTTTACATCGTGATCTTAAGCCGAGCAATCTGTTCTTGAATGCGAATTGCGACCTCAAAATTGGAGATTTTGGCCTTGCAAGAACGACATCAGAAGCGGATTTTATGACAGAGTACGTCGTTACTCGTTGGTACAGAGCACCGGAATTGCTCCTTAACTGTTCCGAGTACACTGCTGCCATCGATACTTGGTCCGTCGGATGTATTCTAGGCGAAATCGTAACCCGAGAGCCATTGTTTCCCGGAAAGGATTACGTTCATCAGCTTAGGCTAATTACCGAGTTGATAGGTTCCCCAGATGACTCCAGTCTTGGGTTTCTTCGAAGCGACAATGCCCGGAGGTATGTAAGACAACTTTCCACAT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002509851.1	big map kinase/bmk, putative	Ricinus communis	387	515 bits (1326)	e-144	248/278 (89%)	261/278 (93%)	+2

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[72 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Organismal Systems	Environmental Adaptation	04626	Plant-pathogen interaction	[PATH:ath04626]	FCTEVCPM034_F02_PDNR-F	AT4G01370	FCTEVCP
Organismal Systems	Immune System	04650	Natural killer cell mediated cytotoxicity	[PATH:ath04650]	FCTEVCPM034_F02_PDNR-F	AT4G01370	FCTEVCP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT4G01370	AT4G01370	cytoplasm	GO:0005737	other cytoplasmic components
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	kinase activity	GO:0016301	kinase activity
AT4G01370	AT4G01370	response to cold	GO:0009409	response to stress
AT4G01370	AT4G01370	response to cold	GO:0009409	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to stress
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other cellular processes
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other metabolic processes
AT4G01370	AT4G01370	response to biotic stimulus	GO:0009607	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to fungus	GO:0009620	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to stress
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	signal transduction	GO:0007165	signal transduction
AT4G01370	AT4G01370	response to stress	GO:0006950	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to stress
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to abscisic acid stimulus	GO:0009737	other biological processes
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to stress
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	cortical microtubule organization	GO:0043622	cell organization and biogenesis
AT4G01370	AT4G01370	cytoplasm	GO:0005737	other cytoplasmic components
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	kinase activity	GO:0016301	kinase activity
AT4G01370	AT4G01370	response to cold	GO:0009409	response to stress
AT4G01370	AT4G01370	response to cold	GO:0009409	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to stress
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other cellular processes
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other metabolic processes
AT4G01370	AT4G01370	response to biotic stimulus	GO:0009607	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to fungus	GO:0009620	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to stress
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	signal transduction	GO:0007165	signal transduction
AT4G01370	AT4G01370	response to stress	GO:0006950	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to stress
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to abscisic acid stimulus	GO:0009737	other biological processes
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to stress
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	cortical microtubule organization	GO:0043622	cell organization and biogenesis

Gene Network Informations
Gene Network	Interact with..
FCTEVCPM034_F02_PDNR-F[interact with..]	FCTEVCPM099_E11_PDNR-F FCTEVCPM036_E01_PDNR-F FCTEVCPM019_C06_PDNR-F FCTEVCPM034_F02_PDNR-F FCTEVCPM019_E02_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FCTEVCPM099_E11_PDNR-F	1132	ref	NP_001068315.1	Os11g0629500	Oryza sativa (japonica cultivar-group)	296	304 bits (778)	7e-84	154/222 (69%)	178/222 (80%)	+1
FCTEVCPM036_E01_PDNR-F	910	ref	NP_001149721.1	transcription initiation factor IIB	Zea mays	312	314 bits (805)	7e-84	160/179 (89%)	165/179 (92%)	+3
FCTEVCPM019_C06_PDNR-F	915	gb	ACG47588.1	60S ribosomal protein L7a	Zea mays	255	313 bits (802)	2e-83	154/199 (77%)	164/199 (82%)	+1
FCTEVCPM034_F02_PDNR-F	1046	ref	XP_002509851.1	big map kinase/bmk, putative	Ricinus communis	387	515 bits (1326)	e-144	248/278 (89%)	261/278 (93%)	+2
FCTEVCPM019_E02_PDNR-F	997	ref	NP_001051017.1	Os03g0703400	Oryza sativa (japonica cultivar-group)	654	444 bits (1142)	e-126	213/265 (80%)	241/265 (90%)	+3