Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPTEVCPM	FPTEVCPM085_F03_PDNR-F	1143

Contig Map:

(ProjectName=FPTEVCPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPTEVCPM085_F03_PDNR-F](Singleton Sequence)

FPTEVCPM085_F03_PDNR-F 1143  bases 
GTGCAGTACAATGTTTACGGCAACTTATTTGAGGTCTCCACCAAATACGTTCCCCCCTTGCGGCCTGTGGGCCGAGGTGCCTATGGCATTGTCTGCGCTGCAGTGAATTCACAGACACGTGAAGAGGTTGCCATTAAGAAGATTGGCAATGCATTTGACAATAGAGTTGATGCGAAGAGAACTTTAAGAGAAATAATGCTTCTTCGTCATTTGAATCATGAAAATATAATTGGTATCAAGGATATCATCCGCCCTCCGAAAAGGGAAACTTTTAATGATGTCTATATTGTTTATGAACTGATGGAGACAGATCTTCATCAAATTATTCGCTCCAACCAGCCTCTAAATGATGATCATTGTCAGTTTTTCCTCTATCAGCTACTAAGGGGTCTAAAATACGTGCACTCTGCGCATGTTTTACATCGTGATCTTAAGCCGAGCAATCTGTTCTTGAATGCGAATTGCGACCTCAAAATTGGAGATTTTGGCCTTGCAAGAACGACATCAGAAGCGGATTTTATGACAGAGTACGTCGTTACTCGTTGGTACAGAGCACCGGAATTGCTCCTTAACTGTTCCGAGTACACTGCTGCCATCGATACTTGGTCCGTCGGATGTATTCTAGGCGAAATCGTAACCCGAGAGCCATTGTTTCCCGGAAAGGATTACGTTCATCAGCTTAGGCTAATTACTGAGTTGATAGGTTCCCCAGATGACTCCAGTCTTGGGTTTCTTCGAAGCGACAATGCCCGGAGGTATGTAAGACAACTTCCACATTATCCAAAGCAGCAATTTTCTTCAAGGTTTCCGAGCATGTCTCCTGGAGCTAAGGATTTACTTGAGAGAATGTTGGTATTTGACCCAAGCAAGAGAATCACAGTCGATGAAGCCCTTTCACACCCATATTTAGCTTCTCTGCATGACATAAATGATGAACCGATCTGCCACACACCCTTCAATTTCGAATTCGAGCAACCGGCGGTGAAAGAAGAAGACATCAAACGCTCATATACAGAGTGTCTTTGAACTACAACCCTGATCAGTCCACTAGATTTACTACTCTTTAATGTAAATGTTATGACAGATTTTCTTAATCGGTTATGTTTTTTTTCTCCTCTTATGTATGGTGGTGACCTAATGCAT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
gb	ABR10070.1	MAPK	Malus hupehensis	373	605 bits (1560)	e-171	286/334 (85%)	314/334 (94%)	+1

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[72 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Organismal Systems	Environmental Adaptation	04626	Plant-pathogen interaction	[PATH:ath04626]	FPTEVCPM085_F03_PDNR-F	AT4G01370	FPTEVCPM
Organismal Systems	Immune System	04650	Natural killer cell mediated cytotoxicity	[PATH:ath04650]	FPTEVCPM085_F03_PDNR-F	AT4G01370	FPTEVCPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT4G01370	AT4G01370	cytoplasm	GO:0005737	other cytoplasmic components
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	kinase activity	GO:0016301	kinase activity
AT4G01370	AT4G01370	response to cold	GO:0009409	response to stress
AT4G01370	AT4G01370	response to cold	GO:0009409	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to stress
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other cellular processes
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other metabolic processes
AT4G01370	AT4G01370	response to biotic stimulus	GO:0009607	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to fungus	GO:0009620	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to stress
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	signal transduction	GO:0007165	signal transduction
AT4G01370	AT4G01370	response to stress	GO:0006950	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to stress
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to abscisic acid stimulus	GO:0009737	other biological processes
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to stress
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	cortical microtubule organization	GO:0043622	cell organization and biogenesis
AT4G01370	AT4G01370	cytoplasm	GO:0005737	other cytoplasmic components
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	nucleus	GO:0005634	nucleus
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	kinase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	MAP kinase activity	GO:0004707	transferase activity
AT4G01370	AT4G01370	kinase activity	GO:0016301	kinase activity
AT4G01370	AT4G01370	response to cold	GO:0009409	response to stress
AT4G01370	AT4G01370	response to cold	GO:0009409	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to stress
AT4G01370	AT4G01370	hyperosmotic response	GO:0006972	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other cellular processes
AT4G01370	AT4G01370	phosphorylation	GO:0016310	other metabolic processes
AT4G01370	AT4G01370	response to biotic stimulus	GO:0009607	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to fungus	GO:0009620	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to stress
AT4G01370	AT4G01370	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	signal transduction	GO:0007165	signal transduction
AT4G01370	AT4G01370	response to stress	GO:0006950	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to stress
AT4G01370	AT4G01370	jasmonic acid and ethylene-dependent systemic resistance	GO:0009861	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to stress
AT4G01370	AT4G01370	"jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009868	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to stress
AT4G01370	AT4G01370	"systemic acquired resistance, salicylic acid mediated signaling pathway"	GO:0009862	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	response to abscisic acid stimulus	GO:0009737	other biological processes
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to stress
AT4G01370	AT4G01370	hypotonic salinity response	GO:0042539	response to abiotic or biotic stimulus
AT4G01370	AT4G01370	cortical microtubule organization	GO:0043622	cell organization and biogenesis

Gene Network Informations
Gene Network	Interact with..
FPTEVCPM085_F03_PDNR-F[interact with..]	FPTEVCPM068_C03_PDNR-F FPTEVCPM066_G12_PDNR-F Contig0034 Contig1082 FPTEVCPM077_A09_PDNR-F FPTEVCPM085_F03_PDNR-F FPTEVCPM033_H09_PDNR-F FPTEVCPM067_B05_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPTEVCPM068_C03_PDNR-F	1102	gb	AAS68103.1	minichromosomal maintenance factor	Triticum aestivum	955	560 bits (1444)	e-158	284/360 (78%)	318/360 (88%), Gaps = 2/360 (0%)	+1
FPTEVCPM066_G12_PDNR-F	1164	ref	NP_001149721.1	transcription initiation factor IIB	Zea mays	312	441 bits (1133)	e-132	215/232 (92%)	226/232 (97%)	+1
Contig0034	760	ref	XP_002323429.1	predicted protein	Populus trichocarpa	151	184 bits (468)	6e-45	92/117 (78%)	96/117 (82%)	+1
Contig1082	1071	emb	CBI15705.1	unnamed protein product	Vitis vinifera	300	377 bits (968)	e-102	190/237 (80%)	195/237 (82%)	+2
FPTEVCPM077_A09_PDNR-F	1008	gb	ACG47588.1	60S ribosomal protein L7a	Zea mays	255	315 bits (806)	6e-84	155/199 (77%)	165/199 (82%)	+2
FPTEVCPM085_F03_PDNR-F	1143	gb	ABR10070.1	MAPK	Malus hupehensis	373	605 bits (1560)	e-171	286/334 (85%)	314/334 (94%)	+1
FPTEVCPM033_H09_PDNR-F	745	ref	XP_002464024.1	hypothetical protein SORBIDRAFT_01g010800	Sorghum bicolor	653	155 bits (391)	5e-36	69/95 (72%)	84/95 (88%)	+3
FPTEVCPM067_B05_PDNR-F	1039	ref	XP_002464024.1	hypothetical protein SORBIDRAFT_01g010800	Sorghum bicolor	653	371 bits (952)	e-101	176/219 (80%)	203/219 (92%)	+3