Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FEICP	EICPS033_B01_pDNR-F	1050

Contig Map:

(ProjectName=FEICP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[EICPS033_B01_pDNR-F](Singleton Sequence)

EICPS033_B01_pDNR-F 1050  bases 
CGGTAAATGCGTGGGATTCGGCCATTACGGCCGGGATTGATGCTAATGGCATTCTGAATGTTTCTCTGAGGATAAAACAACTGGGCAGAAGAATAAGATCACAATCACCAATGACAAGGGCCGGCTGAGCAAGGAAGAGATTGAGAAGATGGTTCAGGAAGCGGAGAAGTATAAATCTGAGGATGAGGAACACAAGAAGAAGGTGGAGGCCAAAAACACATTGGAGAATTATGCTTACAACATGAGGAACACCATCAAGGATGAGAAGATTGCCTCGAAGCTTGCTTCTGATGACAAGAAGAAGATTGAAGATGCGATTGATCAGGCCATCCAGTGGCTTGAAAGTAATCAGTTGGCGGAGGCTGATGAGTTTGATGACAAGATGAAGGAATTGGAGGGCATCTGCAACCCCATCATTGCCAAGATGTACCAGGGAGCTGGACCTGATATGGGTGGAATGTCTGATGATATTCCAACTGGTGGTGGTAGTGGTGCTGGTCCCAAGATTGAAGAGGTCGATTAAAATTTTAAACTTATAGTTATATCGCAACTTGTTTGGATTCACTTTACTGCAGACTTATTTTCATTTGTTCTCGTGTCTCTTCCTTTTGAAAAACTTGATATTAGGTGTTTGCTCGTCTTTGACAATTTTTATTCTATGGTTATATCGTTTTGTGTTTTAGACAGAAAAAATAAAAGAAAAAAAAGAGATCAAGTAGAGCTCGATGAGATACACCGAGAGAAAATTACAGGTAGCGCATAACAGATAGAACATCAAACGTGTGCGGGCGGCTGCGGCTAGAGAGCTTCTAGACATTCTGGGCGCGCGGCCCAATAGAAAGGAAATTGTCATTGCTTTTTCTAGAAATCCTGTCTTGATTGTGCTTGAATCCCACAATAAAAACGCCCCGGGGCAACCGAGCGTTTGAAAAATCAAAGGAATCGAAGTCATTTCTGAATCCTACACGGAATCAGCTAATCGAATCAATAGCTGGCTGCATTATCGAGATACTGTGAATCATAAGCATTCGCGCACTGAAGCATACAAAC

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002332589.1	predicted protein	Populus trichocarpa	648	282 bits (721)	3e-75	139/153 (90%)	147/153 (96%), Gaps = 1/153 (0%)	+2

KEGG Pathway	GO
NoContigFind[3 Pathway]	NoContigFind[60 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04144	Endocytosis	[PATH:ath04144]	EICPS033_B01_pDNR-F	AT3G12580	FEICP
Genetic Information Processing	Folding, Sorting and Degradation	04141	Protein processing in endoplasmic reticulum	[PATH:ath04141]	EICPS033_B01_pDNR-F	AT3G12580	FEICP
Genetic Information Processing	Transcription	03040	Spliceosome	[PATH:ath03040]	EICPS033_B01_pDNR-F	AT3G12580	FEICP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G12580	AT3G12580	cell wall	GO:0005618	cell wall
AT3G12580	AT3G12580	mitochondrion	GO:0005739	mitochondria
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	ATP binding	GO:0005524	nucleotide binding
AT3G12580	AT3G12580	response to cadmium ion	GO:0046686	other biological processes
AT3G12580	AT3G12580	cytosol	GO:0005829	cytosol
AT3G12580	AT3G12580	response to heat	GO:0009408	response to stress
AT3G12580	AT3G12580	response to heat	GO:0009408	response to stress
AT3G12580	AT3G12580	response to heat	GO:0009408	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to heat	GO:0009408	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	protein folding	GO:0006457	protein metabolism
AT3G12580	AT3G12580	protein folding	GO:0006457	other cellular processes
AT3G12580	AT3G12580	protein folding	GO:0006457	other metabolic processes
AT3G12580	AT3G12580	response to bacterium	GO:0009617	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to high light intensity	GO:0009644	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to virus	GO:0009615	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to temperature stimulus	GO:0009266	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to hydrogen peroxide	GO:0042542	response to stress
AT3G12580	AT3G12580	cell wall	GO:0005618	cell wall
AT3G12580	AT3G12580	mitochondrion	GO:0005739	mitochondria
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	ATP binding	GO:0005524	nucleotide binding
AT3G12580	AT3G12580	response to cadmium ion	GO:0046686	other biological processes
AT3G12580	AT3G12580	cytosol	GO:0005829	cytosol
AT3G12580	AT3G12580	response to heat	GO:0009408	response to stress
AT3G12580	AT3G12580	response to heat	GO:0009408	response to stress
AT3G12580	AT3G12580	response to heat	GO:0009408	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to heat	GO:0009408	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	protein folding	GO:0006457	protein metabolism
AT3G12580	AT3G12580	protein folding	GO:0006457	other cellular processes
AT3G12580	AT3G12580	protein folding	GO:0006457	other metabolic processes
AT3G12580	AT3G12580	response to bacterium	GO:0009617	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to high light intensity	GO:0009644	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to virus	GO:0009615	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to temperature stimulus	GO:0009266	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to hydrogen peroxide	GO:0042542	response to stress
AT3G12580	AT3G12580	cell wall	GO:0005618	cell wall
AT3G12580	AT3G12580	mitochondrion	GO:0005739	mitochondria
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	plasma membrane	GO:0005886	plasma membrane
AT3G12580	AT3G12580	ATP binding	GO:0005524	nucleotide binding
AT3G12580	AT3G12580	response to cadmium ion	GO:0046686	other biological processes
AT3G12580	AT3G12580	cytosol	GO:0005829	cytosol
AT3G12580	AT3G12580	response to heat	GO:0009408	response to stress
AT3G12580	AT3G12580	response to heat	GO:0009408	response to stress
AT3G12580	AT3G12580	response to heat	GO:0009408	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to heat	GO:0009408	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	protein folding	GO:0006457	protein metabolism
AT3G12580	AT3G12580	protein folding	GO:0006457	other cellular processes
AT3G12580	AT3G12580	protein folding	GO:0006457	other metabolic processes
AT3G12580	AT3G12580	response to bacterium	GO:0009617	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to high light intensity	GO:0009644	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to virus	GO:0009615	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to temperature stimulus	GO:0009266	response to abiotic or biotic stimulus
AT3G12580	AT3G12580	response to hydrogen peroxide	GO:0042542	response to stress

Gene Network Informations
Gene Network	Interact with..
EICPS033_B01_pDNR-F[interact with..]	EICPM044_E08_pDNR-F EICPS048_E11_pDNR-F EICPM025_B12_pDNR-F Contig2599 EICPM038_F05_pDNR-F EICPS043_E03_pDNR-F EICPS029_G06_pDNR-F EICPS040_A12_pDNR-F EICPM032_A11_pDNR-F Contig3088 Contig2784 EICPM039_A05_pDNR-F EICPS010_F02_pDNR-F EICPS021_E01_pDNR-F EICPS033_B01_pDNR-F EICPS042_G12_pDNR-F EICPM053_E07_pDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
EICPM044_E08_pDNR-F	1048	gb	ABI48954.1	putative protein translation factor Sui1	Viola baoshanensis	113	57.8 bits (138)	6e-16	30/53 (56%)	38/53 (71%)	+3
EICPS048_E11_pDNR-F	739	gb	ACF06581.1	translational initiation factor eIF1	Elaeis guineensis	113	170 bits (430)	2e-40	87/113 (76%)	95/113 (84%)	+2
EICPM025_B12_pDNR-F	1007	ref	XP_002263010.1	PREDICTED: hypothetical protein	Vitis vinifera	222	387 bits (993)	e-105	189/222 (85%)	203/222 (91%)	+1
Contig2599	1085	ref	XP_002513374.1	proteasome subunit alpha type, putative	Ricinus communis	235	426 bits (1095)	e-117	217/235 (92%)	225/235 (95%)	+3
EICPM038_F05_pDNR-F	1034	ref	XP_002278126.1	PREDICTED: hypothetical protein	Vitis vinifera	235	402 bits (1032)	e-112	204/220 (92%)	212/220 (96%)	+3
EICPS043_E03_pDNR-F	747	ref	XP_002513374.1	proteasome subunit alpha type, putative	Ricinus communis	235	291 bits (745)	5e-77	145/159 (91%)	152/159 (95%)	+1
EICPS029_G06_pDNR-F	850	ref	XP_002327807.1	predicted protein	Populus trichocarpa	638	241 bits (616)	5e-62	114/137 (83%)	119/137 (86%)	+1
EICPS040_A12_pDNR-F	786	ref	NP_001057825.1	Os06g0548000	Oryza sativa (japonica cultivar-group)	463	124 bits (312)	8e-27	62/81 (76%)	69/81 (85%)	+2
EICPM032_A11_pDNR-F	1024	ref	NP_001048937.1	Os03g0143300	Oryza sativa (japonica cultivar-group)	453	216 bits (551)	4e-90	99/131 (75%)	115/131 (87%)	+1
Contig3088	1135	ref	XP_002320580.1	predicted protein	Populus trichocarpa	401	382 bits (982)	e-104	213/294 (72%)	237/294 (80%), Gaps = 11/294 (3%)	+3
Contig2784	1512	ref	XP_002332589.1	predicted protein	Populus trichocarpa	648	730 bits (1884)	0.0	369/409 (90%)	378/409 (92%), Gaps = 1/409 (0%)	+2
EICPM039_A05_pDNR-F	1034	gb	ACJ11740.1	heat shock protein 70	Gossypium hirsutum	647	486 bits (1252)	e-139	248/263 (94%)	251/263 (95%)	+1
EICPS010_F02_pDNR-F	752	gb	AAF34134.1	high molecular weight heat shock protein	Malus x domestica	650	280 bits (715)	1e-73	143/169 (84%)	148/169 (87%), Gaps = 3/169 (1%)	+3
EICPS021_E01_pDNR-F	712	ref	XP_002332589.1	predicted protein	Populus trichocarpa	648	228 bits (582)	3e-58	112/124 (90%)	118/124 (95%), Gaps = 1/124 (0%)	+3
EICPS033_B01_pDNR-F	1050	ref	XP_002332589.1	predicted protein	Populus trichocarpa	648	282 bits (721)	3e-75	139/153 (90%)	147/153 (96%), Gaps = 1/153 (0%)	+2
EICPS042_G12_pDNR-F	768	gb	AAF34134.1	high molecular weight heat shock protein	Malus x domestica	650	289 bits (740)	2e-76	148/173 (85%)	152/173 (87%), Gaps = 3/173 (1%)	+2
EICPM053_E07_pDNR-F	976	ref	XP_002327494.1	predicted protein	Populus trichocarpa	703	427 bits (1098)	e-118	214/243 (88%)	230/243 (94%)	+3