Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPTEVCPM	FPTEVCPM025_G03_PDNR-F	1061

Contig Map:

(ProjectName=FPTEVCPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPTEVCPM025_G03_PDNR-F](Singleton Sequence)

FPTEVCPM025_G03_PDNR-F 1061  bases 
TATGCGAGTCCTTCTCCGCCGAAAACCCTACGAATCGCCGTCTCCTTGTCCTCGTCGATGACCTCGCCATCCGCTCATCTCATTCCCTCTTCTTCAAGTCCCTCGAGTCTCGGGGCTTTATTCTCGAATTCCGCCTCGCCGACGATCCGAAGATTTCCCTCCAGAGATACGGCCACTACCTGTATGACGGCCTCGTCATTTTCTCTCCTTCCGTCCAGCGTTTTGGGGGATCACTTGACCAGGTCGCCGTGCTGGACTTCGTTGATGCGGGGCACGATCTGATCCTGGCTGCGGACTCTTCCGCGTCGGACCTGATCAGGGCGATCGCCTCAGAGTGCGGTGTAGATTTTGACGAGGATCCGGATGCCGTTGTTATCGATCACGCTGGTTATGCTGTTTTGGAGACTGATGGAGAACACACGCTCATTGCTGCGGATGATTTTATACAGTCTGATGTGATTTTGGGAGAGAAAGTGATAGAGGCTCCTGTATTATTTCGTGGAATTGGACATTCTGTAAATTCTGCCAGTACTTTGGCCTTGAAAGTGTTGTCTGCTTCTCCTTCAGCTTATTCAGCAAACCCAAGAACTAAGTTGTCAAGTTCTTCCCTCACAGGTTCCACAATTGCATTAGTGTCCGTTGTGCAGGCTAGAAATAATGCTCGCATGTTGATCTCCGGTTCGTTGGATCTTTTTAGTAACAGATTTCTTAGGTCTGGAGTACTGAAGGCTGGAAGCTTAAACAAGCATATAAAGTCTGGCAATGAGCAATTCGCGACAGAAATCAGCAAATGGGTCTTTCATGAGAGGGGTCATCTAAAGGCTGTAAATGTTACTCATCGCAGAGCAGCAGAGATGTCTGAACCTGCAATGTACCGTATCAATGATGATCTGGAATATTCTGTTGAAATCTACGAATGGTCTGGAGCCTCTGAAACCATATGTGGCAGATGATGTTCAGGTTCAATTCTATATGATGAGCCCTTACGTATTGAAAACTTTGTCCACTGACCTAAAGGGACTTTATTTACATCATTCAGGTTCCGGATGTTTATGGCGTCT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	NP_001059165.1	Os07g0209000	Oryza sativa (japonica cultivar-group)	439	449 bits (1154)	e-136	223/303 (73%)	256/303 (84%), Gaps = 1/303 (0%)	+3

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[78 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Genetic Information Processing	Folding, Sorting and Degradation	04141	Protein processing in endoplasmic reticulum	[PATH:ath04141]	FPTEVCPM025_G03_PDNR-F	AT5G66680	FPTEVCPM
Metabolism	Glycan Biosynthesis and Metabolism	00510	N-Glycan biosynthesis	[PATH:ath00510]	FPTEVCPM025_G03_PDNR-F	AT5G66680	FPTEVCPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT5G66680	AT5G66680	membrane	GO:0016020	other membranes
AT5G66680	AT5G66680	nucleolus	GO:0005730	nucleus
AT5G66680	AT5G66680	nucleolus	GO:0005730	other intracellular components
AT5G66680	AT5G66680	plasma membrane	GO:0005886	plasma membrane
AT5G66680	AT5G66680	vacuole	GO:0005773	other cytoplasmic components
AT5G66680	AT5G66680	vacuole	GO:0005773	other intracellular components
AT5G66680	AT5G66680	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	GO:0004579	transferase activity
AT5G66680	AT5G66680	plant-type cell wall	GO:0009505	cell wall
AT5G66680	AT5G66680	endoplasmic reticulum	GO:0005783	ER
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	ER
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	ER
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other membranes
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other cytoplasmic components
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other intracellular components
AT5G66680	AT5G66680	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	GO:0004579	transferase activity
AT5G66680	AT5G66680	plant-type cell wall organization	GO:0009664	cell organization and biogenesis
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	protein metabolism
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other cellular processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other metabolic processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	protein metabolism
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other cellular processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other metabolic processes
AT5G66680	AT5G66680	unidimensional cell growth	GO:0009826	other cellular processes
AT5G66680	AT5G66680	membrane	GO:0016020	other membranes
AT5G66680	AT5G66680	nucleolus	GO:0005730	nucleus
AT5G66680	AT5G66680	nucleolus	GO:0005730	other intracellular components
AT5G66680	AT5G66680	plasma membrane	GO:0005886	plasma membrane
AT5G66680	AT5G66680	vacuole	GO:0005773	other cytoplasmic components
AT5G66680	AT5G66680	vacuole	GO:0005773	other intracellular components
AT5G66680	AT5G66680	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	GO:0004579	transferase activity
AT5G66680	AT5G66680	plant-type cell wall	GO:0009505	cell wall
AT5G66680	AT5G66680	endoplasmic reticulum	GO:0005783	ER
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	ER
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	ER
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other membranes
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other cytoplasmic components
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other intracellular components
AT5G66680	AT5G66680	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	GO:0004579	transferase activity
AT5G66680	AT5G66680	plant-type cell wall organization	GO:0009664	cell organization and biogenesis
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	protein metabolism
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other cellular processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other metabolic processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	protein metabolism
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other cellular processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other metabolic processes
AT5G66680	AT5G66680	unidimensional cell growth	GO:0009826	other cellular processes
AT5G66680	AT5G66680	membrane	GO:0016020	other membranes
AT5G66680	AT5G66680	nucleolus	GO:0005730	nucleus
AT5G66680	AT5G66680	nucleolus	GO:0005730	other intracellular components
AT5G66680	AT5G66680	plasma membrane	GO:0005886	plasma membrane
AT5G66680	AT5G66680	vacuole	GO:0005773	other cytoplasmic components
AT5G66680	AT5G66680	vacuole	GO:0005773	other intracellular components
AT5G66680	AT5G66680	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	GO:0004579	transferase activity
AT5G66680	AT5G66680	plant-type cell wall	GO:0009505	cell wall
AT5G66680	AT5G66680	endoplasmic reticulum	GO:0005783	ER
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	ER
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G66680	AT5G66680	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	ER
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other membranes
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other cytoplasmic components
AT5G66680	AT5G66680	oligosaccharyltransferase complex	GO:0008250	other intracellular components
AT5G66680	AT5G66680	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	GO:0004579	transferase activity
AT5G66680	AT5G66680	plant-type cell wall organization	GO:0009664	cell organization and biogenesis
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	protein metabolism
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other cellular processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other metabolic processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	protein metabolism
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other cellular processes
AT5G66680	AT5G66680	protein N-linked glycosylation via asparagine	GO:0018279	other metabolic processes
AT5G66680	AT5G66680	unidimensional cell growth	GO:0009826	other cellular processes

Gene Network Informations
Gene Network	Interact with..
FPTEVCPM025_G03_PDNR-F[interact with..]	FPTEVCPM059_E07_PDNR-F Contig0927 FPTEVCPM082_E02_PDNR-F FPTEVCPM078_H01_PDNR-F FPTEVCPM025_A04_PDNR-F FPTEVCPM005_H03_PDNR-F FPTEVCPM025_G03_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPTEVCPM059_E07_PDNR-F	1144	ref	XP_002301238.1	predicted protein	Populus trichocarpa	479	360 bits (923)	e-103	173/263 (65%)	208/263 (79%), Gaps = 7/263 (2%)	+1
Contig0927	1757	gb	ACQ91203.1	calreticulin	Carica papaya	422	589 bits (1519)	e-166	267/333 (80%)	294/333 (88%)	+1
FPTEVCPM082_E02_PDNR-F	1132	ref	XP_002316504.1	predicted protein	Populus trichocarpa	431	416 bits (1070)	e-139	208/232 (89%)	222/232 (95%)	+1
FPTEVCPM078_H01_PDNR-F	868	ref	NP_001055755.1	Os05g0460200	Oryza sativa (japonica cultivar-group)	169	288 bits (736)	6e-76	133/147 (90%)	141/147 (95%)	+3
FPTEVCPM025_A04_PDNR-F	1056	ref	XP_002280521.1	PREDICTED: hypothetical protein	Vitis vinifera	778	435 bits (1118)	e-120	225/311 (72%)	243/311 (78%)	+2
FPTEVCPM005_H03_PDNR-F	1158	ref	XP_002511066.1	calnexin, putative	Ricinus communis	542	444 bits (1142)	e-123	205/291 (70%)	232/291 (79%)	+1
FPTEVCPM025_G03_PDNR-F	1061	ref	NP_001059165.1	Os07g0209000	Oryza sativa (japonica cultivar-group)	439	449 bits (1154)	e-136	223/303 (73%)	256/303 (84%), Gaps = 1/303 (0%)	+3