Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPEAECP	FPEAECP033_E12_PDNR-F	1004

Contig Map:

(ProjectName=FPEAECP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPEAECP033_E12_PDNR-F](Singleton Sequence)

FPEAECP033_E12_PDNR-F 1004  bases 
GCCCCGCTTTCTTTTGGTCGAGTTCCGCCGCCATTTTCTTAGAGATCCGAATCCACAGCGCTCGATCTAGAGGAGGGATTGCAGTTAGGAAAATGACGGAGTCGGAGGCGAACTCTGTGATCCCGGAGTCCGTATTGAAAAAGCGCAAGAGGGAGGAGCAGTGGGCTTTAGAGAAGAAGCAGAAGTTAGATGAGAAGAGGAAGAAGAATAAAGAGAATCGCAAACTCATTTTTAAGAGGGCAGAACAGTATGTCAAAGAGTACCAGAAGCAGGAGAGGGAGCTGATACAGCTAAAGCGCGAGGCTAGACTGAAAGGAGGATTCTACGTTTGCCCCGAGGCCAAGCTTCTGTTCATCATCAGAATCCGCGGGATCAATGCTATTGACCCAAAAACTAAGAAGATTTTGCAGCTTTTGCGCCTGAGACAGATTTTTAATGGAGTATTCTTAAAAGTGAACAAAGCTACCATTAATATGCTCCGAAGAGTGGAGCCCTATGTCACCTATGGTTATCCAAACCTTAAAAGTGTAAGGGAGTTGATATACAAGAGGGGCTATGGGAAACTGAACAAGCAAAGGATTCCATTGACCAGCAATGACATCATTGAGCAGGGGCTAGGAAAGCATGATATTATATGCATTGAGGACCTCATTCATGAAATTTTCTCTGTAGGGCCTCATTTTAAGGAGGCCAATAACTTTCTTTGGCCATTTAAGCTGAAGGCACCACTTGGAGGTCTGAAGAAGAAGAGGAATCATTATGTTGAAGGTGGAGATGCTGGAAACAGGGAAGATTACATAAACGAGCTTATCCGCCGCATGAACTAGGTTTAGTCGCCCTTCTTGCATCATCTATATTGGTTCTTTGAGGAACAAATTTGAGACTTGCTGCAGTTTTTTTGTTTGCTTATTTTGAGTGGACGAATTTTCAGTCAGAATTAATTTCTGTTCTATTTTGTTTCATATGATGACTAAAGATTTTTTCTGTTTTATGATGATTCCAAA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	NP_187967.1	60S ribosomal protein L7 (RPL7D)	Arabidopsis thaliana	244	369 bits (946)	e-100	183/244 (75%)	201/244 (82%)	+3

KEGG Pathway	GO
NoContigFind[1 Pathway]	NoContigFind[58 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Genetic Information Processing	Translation	03010	Ribosome	[PATH:ath03010]	FPEAECP033_E12_PDNR-F	AT3G13580	FPEAECP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G13580	AT3G13580	chloroplast	GO:0009507	chloroplast
AT3G13580	AT3G13580	membrane	GO:0016020	other membranes
AT3G13580	AT3G13580	structural constituent of ribosome	GO:0003735	structural molecule activity
AT3G13580	AT3G13580	translation	GO:0006412	protein metabolism
AT3G13580	AT3G13580	translation	GO:0006412	other cellular processes
AT3G13580	AT3G13580	translation	GO:0006412	other metabolic processes
AT3G13580	AT3G13580	transcription regulator activity	GO:0030528	other molecular functions
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components
AT3G13580	AT3G13580	large ribosomal subunit	GO:0015934	ribosome
AT3G13580	AT3G13580	large ribosomal subunit	GO:0015934	other cytoplasmic components
AT3G13580	AT3G13580	large ribosomal subunit	GO:0015934	other intracellular components
AT3G13580	AT3G13580	structural constituent of ribosome	GO:0003735	structural molecule activity
AT3G13580	AT3G13580	translation	GO:0006412	protein metabolism
AT3G13580	AT3G13580	translation	GO:0006412	other cellular processes
AT3G13580	AT3G13580	translation	GO:0006412	other metabolic processes
AT3G13580	AT3G13580	cytosolic large ribosomal subunit	GO:0022625	cytosol
AT3G13580	AT3G13580	cytosolic large ribosomal subunit	GO:0022625	ribosome
AT3G13580	AT3G13580	cytosolic large ribosomal subunit	GO:0022625	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic large ribosomal subunit	GO:0022625	other intracellular components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components
AT3G13580	AT3G13580	membrane	GO:0016020	other membranes
AT3G13580	AT3G13580	structural constituent of ribosome	GO:0003735	structural molecule activity
AT3G13580	AT3G13580	translation	GO:0006412	protein metabolism
AT3G13580	AT3G13580	translation	GO:0006412	other cellular processes
AT3G13580	AT3G13580	translation	GO:0006412	other metabolic processes
AT3G13580	AT3G13580	transcription regulator activity	GO:0030528	other molecular functions
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components
AT3G13580	AT3G13580	membrane	GO:0016020	other membranes
AT3G13580	AT3G13580	structural constituent of ribosome	GO:0003735	structural molecule activity
AT3G13580	AT3G13580	translation	GO:0006412	protein metabolism
AT3G13580	AT3G13580	translation	GO:0006412	other cellular processes
AT3G13580	AT3G13580	translation	GO:0006412	other metabolic processes
AT3G13580	AT3G13580	transcription regulator activity	GO:0030528	other molecular functions
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	cytosol
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	ribosome
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other cytoplasmic components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components
AT3G13580	AT3G13580	cytosolic ribosome	GO:0022626	other intracellular components

Gene Network Informations
Gene Network	Interact with..
FPEAECP033_E12_PDNR-F[interact with..]	FPEAECP029_E11_PDNR-F FPEAECP026_D12_PDNR-F FPEAECP005_G01_PDNR-F Contig0351 Contig0294 FPEAECP033_E12_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPEAECP029_E11_PDNR-F	1021	emb	CAA65987.2	ribosomal protein L9	Pisum sativum	195	227 bits (579)	1e-67	114/163 (69%)	135/163 (82%), Gaps = 3/163 (1%)	+2
FPEAECP026_D12_PDNR-F	818	gb	ACG47565.1	60S ribosomal protein L17	Zea mays	171	293 bits (749)	2e-77	144/152 (94%)	147/152 (96%)	+3
FPEAECP005_G01_PDNR-F	764	gb	ABA40430.1	ribosomal protein L27a-like protein	Solanum tuberosum	148	259 bits (663)	1e-67	124/149 (83%)	129/149 (86%)	+3
Contig0351	593	gb	AAT08714.1	ribosomal protein L18A	Hyacinthus orientalis	178	169 bits (428)	1e-40	81/86 (94%)	83/86 (96%)	+2
Contig0294	1056	gb	ACF06468.1	40S ribosomal protein S5	Elaeis guineensis	195	355 bits (911)	4e-96	179/195 (91%)	188/195 (96%)	+1
FPEAECP033_E12_PDNR-F	1004	ref	NP_187967.1	60S ribosomal protein L7 (RPL7D)	Arabidopsis thaliana	244	369 bits (946)	e-100	183/244 (75%)	201/244 (82%)	+3