Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPEAECP	FPEAECP014_G06_PDNR-F	1046

Contig Map:

(ProjectName=FPEAECP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPEAECP014_G06_PDNR-F](Singleton Sequence)

FPEAECP014_G06_PDNR-F 1046  bases 
GTACTTTAGATTTTACCTCATCTCTGACTTGGTCTCCTGTACTTATATCACCGAAGATGGCTTACGGAGATCGCCTGACGAGCTTCGAGGATTCGGAGAAGGAGAGCGAGTATGGATATGTTCGCAAGGTATCAGGTCCGGTTGTGGTTGCAGATGGAATGGGAGGAGCAGCAATGTATGAGCTGGTTCGAGTTGGTCATGACAACCTCATTTGAGAAATCATCAGGTTGGAGGGAGATTCTGCTACCATTCAAGTTTATGAAGAAACAGCTGGATTAACGGTGAATGACCCTGTTCTGCGAACTCGAAAGCCTCTTTCGGTTGAGCTGGGGCCTGGGATATTAGGGAACATTTTTGATGGAATTCAGAGACCTTTAAAAACTATTGCGATTAAATCTGGTGATGTTTATATCCCCCGTGGGGTTGCAGTTCCTGCTCTTGACAAAGATTTCTTGTGGGGCTTTGAGCCAAAGAAGTTTTCTGTTGGAGATCATCTCACTGGTGGAGATTTATATGCTACTGTCTTTGAGAATACCTTGATGCAACACCACGTTGCACTTCCTCCTGGTGCCATGGGAAAAATTTCATACATTGCTCCATCTGGTCAATACAGCTTAAAGGATACCGTGCTTGAAGTTGAGTTTCAAGGTGTGAAAAAGGAGTATACTATGCTTCAGACCTGGCCAGTGCGTTCACCAAGGCCTGTTGCTTCAAAGCTTGCTGCGGATACACCTCTGTTGACTGGGCAACGTGTTCTTGATGCCCTTTTCCCCTCTGTACTTGGAGGAACTTGTGCTATTCCTGGAGCTTTTGGTTGTGGTAAAACTGTTATTAGTCAAGCACTCTCTAAGTACTCAAATTCTGACATAGTGGTCTATGTGGGCTGTGGAGAAAGAGGGAATGAGATGGCTGAGGTGCTCATGGATTTTCCTCAATTAACCATGACTCTTCCTGATGGTCGTGAAGAATCTGTTATGAAACGAACTACACTTGTGGCCAATACTTTCAACATGCCCGTGGCTGCTCGCGAGCCTCATTTATCCGGG

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
gb	ACG48688.1	vacuolar ATP synthase catalytic subunit A	Zea mays	621	606 bits (1562)	e-171	301/325 (92%)	315/325 (96%)	+3

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[204 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04145	Phagosome	[PATH:ath04145]	FPEAECP014_G06_PDNR-F	AT1G78900	FPEAECP
Metabolism	Energy Metabolism	00190	Oxidative phosphorylation	[PATH:ath00190]	FPEAECP014_G06_PDNR-F	AT1G78900	FPEAECP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT1G78900	AT1G78900	cell wall	GO:0005618	cell wall
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	membrane	GO:0016020	other membranes
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	"hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances"	GO:0016820	hydrolase activity
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to stress
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other membranes
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other cytoplasmic components
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	Golgi organization	GO:0007030	cell organization and biogenesis
AT1G78900	AT1G78900	proton transport	GO:0015992	transport
AT1G78900	AT1G78900	pollen development	GO:0009555	developmental processes
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	cell wall	GO:0005618	cell wall
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	membrane	GO:0016020	other membranes
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	cell wall	GO:0005618	cell wall
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	membrane	GO:0016020	other membranes
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	"hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances"	GO:0016820	hydrolase activity
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to stress
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other membranes
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other cytoplasmic components
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	Golgi organization	GO:0007030	cell organization and biogenesis
AT1G78900	AT1G78900	proton transport	GO:0015992	transport
AT1G78900	AT1G78900	pollen development	GO:0009555	developmental processes
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	cell wall	GO:0005618	cell wall
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	membrane	GO:0016020	other membranes
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	"hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances"	GO:0016820	hydrolase activity
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to stress
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	"hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances"	GO:0016820	hydrolase activity
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to stress
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G78900	AT1G78900	cell wall	GO:0005618	cell wall
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	membrane	GO:0016020	other membranes
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	"hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances"	GO:0016820	hydrolase activity
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to stress
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other membranes
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other cytoplasmic components
AT1G78900	AT1G78900	vacuolar membrane	GO:0005774	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	Golgi organization	GO:0007030	cell organization and biogenesis
AT1G78900	AT1G78900	proton transport	GO:0015992	transport
AT1G78900	AT1G78900	pollen development	GO:0009555	developmental processes
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	cell wall	GO:0005618	cell wall
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	chloroplast	GO:0009507	chloroplast
AT1G78900	AT1G78900	membrane	GO:0016020	other membranes
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	plasma membrane	GO:0005886	plasma membrane
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other cytoplasmic components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	vacuole	GO:0005773	other intracellular components
AT1G78900	AT1G78900	ATP binding	GO:0005524	nucleotide binding
AT1G78900	AT1G78900	"hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances"	GO:0016820	hydrolase activity
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to stress
AT1G78900	AT1G78900	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G78900	AT1G78900	plant-type vacuole	GO:0000325	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	plastid
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	chloroplast
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other cytoplasmic components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	chloroplast envelope	GO:0009941	other intracellular components
AT1G78900	AT1G78900	"hydrogen ion transporting ATP synthase activity, rotational mechanism"	GO:0046933	transporter activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G78900	AT1G78900	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity

Gene Network Informations
Gene Network	Interact with..
FPEAECP014_G06_PDNR-F[interact with..]	FPEAECP004_G02_PDNR-F FPEAECP034_D11_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPEAECP004_G02_PDNR-F	1083	gb	ABH07428.1	vacuolar H+-ATPase subunit C	Gossypium hirsutum	377	531 bits (1368)	e-149	267/349 (76%)	292/349 (83%), Gaps = 3/349 (0%)	+1
FPEAECP034_D11_PDNR-F	1180	ref	XP_002523036.1	ATP synthase subunit d, putative	Ricinus communis	261	402 bits (1033)	e-110	216/265 (81%)	228/265 (86%)	+1