Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPEAECP	FPEAECP034_D11_PDNR-F	1180

Contig Map:

(ProjectName=FPEAECP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPEAECP034_D11_PDNR-F](Singleton Sequence)

FPEAECP034_D11_PDNR-F 1180  bases 
TGATCCGGTCTATGCCCGGGATTCGGCCTTACGGCCGGGGATCGTCTGGTGTCTGGTGCTGCGACGTGTGAAGAAGGAGATATCGTGAAGAAGAGCAGGAGTCCATATTTTGTTGGAATTCTCAGTGCAACCTAAAGGGCCGCTAGGGTTACAGAAGATAACGGAAAAATGTCGGGCCAGGGGCAGAGGCTGACCGTGGTGCCGACGGTGACGATGTTGGGCGTGACGAAAGCGCGGCTGGTCGGTGCGACCCGCGGTCACGCTCTCCTGAAGAAGAAGAGCGACGCCCTCACGGTCCAATTCCGCCAGATCCTTAAGAAAATAGTCTCCACAAAGGAGTCCATGGGCGACATCATGCGATCTTCCTCCTTCGCCCTCACGGAGGCCAAGTACGCTGCCGGTGAAAACATTAAACACGTAGTCTTGGAGTCCGTTCGCTCTGCGTCAGTCAAGGTTCGTTCTCGGCAGGAGAACGTTGCAGGTGTGAAGCTCCCTAAGTTTGAACACTTCACTGACTCTGCTGCTGACTCCAAGTCTTCTACTGACCTCACTGGCCTTGCCCGTGGTGGACAGCAGGTCCAGGCCTGCCGTGCCGCACACATCAAGGCAATTGAGGTTCTTGTTGAGCTTGCCTCTCTTCAGACCTCCTTTCTCACACTTGATGAGGCCATCAAGACTACCAACCGAAGGGTCAATGCGCTTGAGAATGTGGTCAAGCCCCGAATTGAGAATACAATCAGCTATATAAAGGGGGAACTTGACGAGCTAGAGAGAGAGGATTTCTTCAGGCTGAAGAAGATCCAGGGATATAAGAAGAGGGAGATAGAAAGGCAAACACAGTCAGCTAAGCAGTTTGCAGAAGAGAAGCGCGTGGAAGAGATTTCTCTGCAGAAGGGGATATCTTTCCATTCTGCACATAATATGCTTGTTGCTGGGGCAGAGAAAGATGAGGACATCATTTTTTAATGGATACCTGATGTTTACTTGTTAGGTTGGATCCTGCAGCGGGCAAAAGTTGCAGCTTGTATTTTACTTTGTCATGGATGCTCGTCTCTGTGATCTGTATGGATTCTTTTCTAGCTGGGTTATGGCATGTAATATTTTATCTTCCAAATCTTTCAGAACCAAATACCACTTTTAATAATTTCATTTATGTATATTCGTCACCTAAATGATCCAA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002523036.1	ATP synthase subunit d, putative	Ricinus communis	261	402 bits (1033)	e-110	216/265 (81%)	228/265 (86%)	+1

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[60 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04145	Phagosome	[PATH:ath04145]	FPEAECP034_D11_PDNR-F	AT3G58730	FPEAECP
Metabolism	Energy Metabolism	00190	Oxidative phosphorylation	[PATH:ath00190]	FPEAECP034_D11_PDNR-F	AT3G58730	FPEAECP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components

Gene Network Informations
Gene Network	Interact with..
FPEAECP034_D11_PDNR-F[interact with..]	FPEAECP005_F01_PDNR-F FPEAECP009_H03_PDNR-F FPEAECP038_G08_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPEAECP005_F01_PDNR-F	936	gb	AAF73016.1	AF262934_1 ubiquitin conjugating protein	Avicennia marina	152	319 bits (818)	2e-85	151/152 (99%)	152/152 (100%)	+1
FPEAECP009_H03_PDNR-F	896	gb	AAF73016.1	AF262934_1 ubiquitin conjugating protein	Avicennia marina	152	319 bits (817)	3e-85	150/152 (98%)	152/152 (100%)	+2
FPEAECP038_G08_PDNR-F	873	gb	AAF73016.1	AF262934_1 ubiquitin conjugating protein	Avicennia marina	152	315 bits (808)	3e-84	149/152 (98%)	151/152 (99%)	+3