Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPEAECP	FPEAECP004_G02_PDNR-F	1083

Contig Map:

(ProjectName=FPEAECP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPEAECP004_G02_PDNR-F](Singleton Sequence)

FPEAECP004_G02_PDNR-F 1083  bases 
AAATCTCTGCCCGGGCATTCGGCCTTACGGCCGGGGGAATCTGCAATGGCGACGAGGTATTGGGTGGTATCCCTCCCCGTCCAATCGTCAGCTCCTGCTCTATGGAGCCGACTGCAGGAATTAATCTCTAAGAAAGCCTTCGACACGCCTCTCTACCGGTTTGACACTCCCGATCTTCGCGTGGGTACCTTGGACTCACTCCTTTCTCTGAGCGACGATCTCTCGAAGTCGAATGCTTTCATAGAAGGGGTGGCGCACAAGATACGCCGGCAAATCGAAGAGTTGGAGCGGGCATCTGGGATCGAAAGCTTGGCTCTTACTGTGGATGGTGTTCCCGTGGATACCTATCTCACGAGGTTCGTTTGGGATGAATCTAAGTATCCCACAGTATCGCCACTTCGGGAGATTGTTGATACTATTCACAATCAAGTAGCCAAAATTGAGGATGATATGAAGATTCGTGCTGCGGAATATAATACTGTGCGTGGGCAACTTAATGCAATAAATAGGAAGCAAACTGGGAGCTTAGCTGTTCGCGATCTTTCCAATTTAGTAAAGCCGGAGGATATCATCACATCCGAGCATTTGGTCACTCTTCTCACAATTGTTCCGAAGTACTCACAGAAGGATTGGTTGTCAAGCTATGAAACGTTGACTACTTACGTGGTACCTCGATCATCTAAAAAGTTGTACGAGGACAATGAGTATGCTCTCTACACCGTAACACTCTTTGGTAGAGTTGCTGACAATTTTAAAATTAGTGCGCGTGAAAGAGGGTTTCAGATCCGAGAATTTGAATATAGTACAGAAGCTCAAGAGAATCGGAAACAAGAGCTGGAAAAACTAATGCAGGATCAGGAAAACTTGAGGAGCTCTCTTTTACAATGGTGTTATGCAAGCTATGGGGAGGTCTTTAGTTCCTGGATGCACTTTTGTGCTGTGCGTGTATTCACTGAGAGCATTCTCAGATATGGTTTGCCGCATCATTCTTGGCTGCAGCTCTTGCGCCGCCGGTGAAAAGTGAGAAAAAGTACGGAACTTGTGGAGCAGCTGTGTGGCAATGTCAACAGCACTTACTGGAAA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
gb	ABH07428.1	vacuolar H+-ATPase subunit C	Gossypium hirsutum	377	531 bits (1368)	e-149	267/349 (76%)	292/349 (83%), Gaps = 3/349 (0%)	+1

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[72 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04145	Phagosome	[PATH:ath04145]	FPEAECP004_G02_PDNR-F	AT1G12840	FPEAECP
Metabolism	Energy Metabolism	00190	Oxidative phosphorylation	[PATH:ath00190]	FPEAECP004_G02_PDNR-F	AT1G12840	FPEAECP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT1G12840	AT1G12840	chloroplast	GO:0009507	chloroplast
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G12840	AT1G12840	plant-type vacuole	GO:0000325	other intracellular components
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other membranes
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other cytoplasmic components
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other intracellular components
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other membranes
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other cytoplasmic components
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other intracellular components
AT1G12840	AT1G12840	lignin biosynthetic process	GO:0009809	other cellular processes
AT1G12840	AT1G12840	lignin biosynthetic process	GO:0009809	other metabolic processes
AT1G12840	AT1G12840	unidimensional cell growth	GO:0009826	other cellular processes
AT1G12840	AT1G12840	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G12840	AT1G12840	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G12840	AT1G12840	regulation of carbohydrate biosynthetic process	GO:0043255	other metabolic processes
AT1G12840	AT1G12840	chloroplast	GO:0009507	chloroplast
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G12840	AT1G12840	plant-type vacuole	GO:0000325	other intracellular components
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other membranes
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other cytoplasmic components
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other intracellular components
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other membranes
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other cytoplasmic components
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other intracellular components
AT1G12840	AT1G12840	lignin biosynthetic process	GO:0009809	other cellular processes
AT1G12840	AT1G12840	lignin biosynthetic process	GO:0009809	other metabolic processes
AT1G12840	AT1G12840	unidimensional cell growth	GO:0009826	other cellular processes
AT1G12840	AT1G12840	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G12840	AT1G12840	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G12840	AT1G12840	chloroplast	GO:0009507	chloroplast
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other cytoplasmic components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	vacuole	GO:0005773	other intracellular components
AT1G12840	AT1G12840	plant-type vacuole	GO:0000325	other cytoplasmic components
AT1G12840	AT1G12840	plant-type vacuole	GO:0000325	other intracellular components
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other membranes
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other cytoplasmic components
AT1G12840	AT1G12840	"vacuolar proton-transporting V-type ATPase, V1 domain"	GO:0000221	other intracellular components
AT1G12840	AT1G12840	plasma membrane	GO:0005886	plasma membrane
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other membranes
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other cytoplasmic components
AT1G12840	AT1G12840	vacuolar membrane	GO:0005774	other intracellular components
AT1G12840	AT1G12840	lignin biosynthetic process	GO:0009809	other cellular processes
AT1G12840	AT1G12840	lignin biosynthetic process	GO:0009809	other metabolic processes
AT1G12840	AT1G12840	unidimensional cell growth	GO:0009826	other cellular processes
AT1G12840	AT1G12840	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT1G12840	AT1G12840	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT1G12840	AT1G12840	regulation of carbohydrate biosynthetic process	GO:0043255	other metabolic processes
AT1G12840	AT1G12840	regulation of carbohydrate biosynthetic process	GO:0043255	other metabolic processes

Gene Network Informations
Gene Network	Interact with..
FPEAECP004_G02_PDNR-F[interact with..]	FPEAECP034_D11_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPEAECP034_D11_PDNR-F	1180	ref	XP_002523036.1	ATP synthase subunit d, putative	Ricinus communis	261	402 bits (1033)	e-110	216/265 (81%)	228/265 (86%)	+1