Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FCTEVCP	FCTEVCPM143_B08_pDNR-F	1018

Contig Map:

(ProjectName=FCTEVCP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FCTEVCPM143_B08_pDNR-F](Singleton Sequence)

FCTEVCPM143_B08_pDNR-F 1018  bases 
ATTGAGGGAATGGATTTCTGATGCGTTGGGCCAACAGGCAATAGCAAAGCATATGGTGGCTGTCAGTACAAATCTGAAGCTTGTGGAGGAATTTGGGATTGATCCGAATAATGCTTTTGCTTTTTGGGACTGGGTTGGTGGTCGCTATAGTGTTTGCAGTGCTGTTGGTGTGCTACCCTTGTCTCTCCAATATGGTTTTCCAGTCATTGAAAAGTTTTTGGATGGAGCTCGTAGCATAGACAAACACTTTTATTCAGCTTCGTTTGATAAAAATATACCTGTGCTATTAGGTTTGTTGAGTGTATGGAATGTCTCGTTTCTTGGATTTCCAGCTAGAGCAATATTGCCATACTCTCAAGCACTTGAGAAGTTTGCTCCACACATTCAACAGTTGAGCATGGAAAGTAATGGAAAGGGTGTATCCATTGATGGCATTCCACTTCCTTTCGAAACTGGTGAAATAGATTTTGGAGAACCAGGAACAAATGGTCAACACAGTTTTTACCAGCTAATACATCAGGGAAGGGTTATTCCTTGTGATTTTATTGGTGTTGTCAAAAGCCAGCGGCCTGTGTATTTGAAAGGAGAAATTGTAAGCAATCATGATGAGCTTATGTCTAATTTCTTTGCACAGCCAGATGCGCTGGCTTATGGGAAGTCCCCGGAACAGCTACAGAGTGAGAATGTGGGGAGTCACCTAATTCCTCATAAGGTTACTGACCTTTTCTGGTAATCGGCCATCTCTCAGTCTTCTTCTACCTTCTTTGTCCGCTTATAATGTTGGACAGGCGGATACTGGCTTACCACCTGACAATTCTACAACGCTGCCAAAATTATAAAATATGTTACACTGAAACTCAAGTCATGTCTTCACCAGCAGCAGAAGATGAACTCTGCTTATTTATCTGTTTTATTATTGGGATAATAATTGGCAGTTGAGGATGCCAATGCTGTAACCCTTATAGCTTGACAATTTCAGATAGACCTGTTTACAACCTTAATAAATGGTCAAGCAAAT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002282774.1	PREDICTED: similar to glucose-6-phosphate isomerase	Vitis vinifera	568	447 bits (1150)	e-124	214/237 (90%)	226/237 (95%)	+2

KEGG Pathway	GO
NoContigFind[4 Pathway]	NoContigFind[66 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Metabolism	Carbohydrate Metabolism	00520	Amino sugar and nucleotide sugar metabolism	[PATH:ath00520]	FCTEVCPM143_B08_pDNR-F	AT5G42740	FCTEVCP
Metabolism	Carbohydrate Metabolism	00010	Glycolysis / Gluconeogenesis	[PATH:ath00010]	FCTEVCPM143_B08_pDNR-F	AT5G42740	FCTEVCP
Metabolism	Carbohydrate Metabolism	00030	Pentose phosphate pathway	[PATH:ath00030]	FCTEVCPM143_B08_pDNR-F	AT5G42740	FCTEVCP
Metabolism	Carbohydrate Metabolism	00500	Starch and sucrose metabolism	[PATH:ath00500]	FCTEVCPM143_B08_pDNR-F	AT5G42740	FCTEVCP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus

Gene Network Informations
Gene Network	Interact with..
FCTEVCPM143_B08_pDNR-F[interact with..]	Contig1389 FCTEVCPM060_C11_PDNR-F Contig1370

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
Contig1389	995	ref	XP_002513958.1	cytochrome C oxidase polypeptide vib, putative	Ricinus communis	191	172 bits (437)	4e-41	97/206 (47%)	118/206 (57%)	+2
FCTEVCPM060_C11_PDNR-F	778	dbj	BAD52630.1	hydroxyethylthiazole kinase-like protein	Oryza sativa Japonica Group	215	184 bits (466)	1e-44	89/132 (67%)	105/132 (79%)	+2
Contig1370	967	gb	ACF06501.1	SKP1	Elaeis guineensis	163	238 bits (608)	5e-61	122/160 (76%)	135/160 (84%), Gaps = 4/160 (2%)	+3