Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPTEVCPM	FPTEVCPM079_E11_PDNR-F	1137

Contig Map:

(ProjectName=FPTEVCPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPTEVCPM079_E11_PDNR-F](Singleton Sequence)

FPTEVCPM079_E11_PDNR-F 1137  bases 
GGTCTCTCTGTTTCGTCCAAAACCATCTCCTTCGTCATCGAATCCCTAGCGATGCAGTCACCGTAGGAGATAGTTGGGAACGTAAGGACGGGATCGCGGCTTCCAGTGATCCCAAACTCCCATTTTTCTCCTCCTTCCGCTCCTCTCCTACTCGAAACCATCGAGGAAGATAATTTATTTAGATGGCTGCCAGAAGAGGCATTAACCAGCTTTTGAGCATGAAATTACATTTTAAGTCATCAATCCCATGGATGTCATCGTTTCTGGGGAAGCAGAATCCAGAGTTTGCTGGATCTGCCGGTATGTCATCTCTTAGAGGATTAGCACTACTTGGGGTTAGTGTTTCTGGAGTTTTAAGCTTTGCTACCATAGCTTCTGCTGATGATGAAGCAGAGCATGGTCTGGCTTGCCCCAGCTATCCTTGGCCGCACAAAGGCATCCTTAGCTCTTATGATCATGCATCAATCCGCCGCGGTCATCAAGTCTATCAACAAGTCTGTGCTTCTTGCCATTCAATGTCTCTGATTTCTTATCGAGATCTTGTTGGTGTGGCATATACTGAAGATGAAGTAAAGGCGATGGCAGCGGAGATTGAGGTGGTTGATGGTCCTAATGATGAAGGCGAGATGTTTACTCGTCCTGGAAAACTAAGTGATCGCTTTCCTAAACCATATGATAATGAACAAGCAGCACGATTTGCCAATGGTGGAGCATATCCTCCAGACTTAAGCTTGATAACTAAGGCCCGACATAATGGACAAAACTATGTTTTTGCTCTTCTTACTGGGTACCGCGATCCCCCTGCTGGTATTTCGATCCGAGATGGTTTGCACTATAATCCATACTTCCCTGGTGGTGCTATAGCTATGCCTCAAATGCTTATTGATGGTGCTGTTGAGTACGAGATGGCACTCCTGCCACCGAAGCCCAGATGGGGAAGATGTGTCGCATTCCTTTCATGGGCGCTGACAGAGATGGAGAGCGCAATTGATGGGATTCAATGGATCTCGTGTGTCTCTTGCTCTGCTCAGCCGCATACTATCGCGCTGCTGTCTATTTCAGTCACGCAGCTGTTCTCGATGTCGTCACTGACTGATCATTTCTCAAGAAAAATTTTGGGGCGGACTAGCTCCATTA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
emb	CBI40072.1	unnamed protein product	Vitis vinifera	310	387 bits (994)	e-105	203/283 (71%)	223/283 (78%), Gaps = 4/283 (1%)	+3

KEGG Pathway	GO
NoContigFind[1 Pathway]	NoContigFind[38 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Metabolism	Energy Metabolism	00190	Oxidative phosphorylation	[PATH:ath00190]	FPTEVCPM079_E11_PDNR-F	AT5G40810	FPTEVCPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT5G40810	AT5G40810	membrane	GO:0016020	other membranes
AT5G40810	AT5G40810	vacuole	GO:0005773	other cytoplasmic components
AT5G40810	AT5G40810	vacuole	GO:0005773	other intracellular components
AT5G40810	AT5G40810	electron carrier activity	GO:0009055	other molecular functions
AT5G40810	AT5G40810	iron ion binding	GO:0005506	other binding
AT5G40810	AT5G40810	heme binding	GO:0020037	other binding
AT5G40810	AT5G40810	mitochondrion	GO:0005739	mitochondria
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	mitochondria
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	other membranes
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	other cytoplasmic components
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	other intracellular components
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	mitochondria
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	other membranes
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	other cytoplasmic components
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	other intracellular components
AT5G40810	AT5G40810	"electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity"	GO:0045153	other molecular functions
AT5G40810	AT5G40810	electron carrier activity	GO:0009055	other molecular functions
AT5G40810	AT5G40810	iron ion binding	GO:0005506	other binding
AT5G40810	AT5G40810	heme binding	GO:0020037	other binding
AT5G40810	AT5G40810	membrane	GO:0016020	other membranes
AT5G40810	AT5G40810	vacuole	GO:0005773	other cytoplasmic components
AT5G40810	AT5G40810	vacuole	GO:0005773	other intracellular components
AT5G40810	AT5G40810	electron carrier activity	GO:0009055	other molecular functions
AT5G40810	AT5G40810	iron ion binding	GO:0005506	other binding
AT5G40810	AT5G40810	heme binding	GO:0020037	other binding
AT5G40810	AT5G40810	mitochondrion	GO:0005739	mitochondria
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	mitochondria
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	other membranes
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	other cytoplasmic components
AT5G40810	AT5G40810	mitochondrial respiratory chain	GO:0005746	other intracellular components
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	mitochondria
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	other membranes
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	other cytoplasmic components
AT5G40810	AT5G40810	mitochondrial respiratory chain complex III	GO:0005750	other intracellular components
AT5G40810	AT5G40810	"electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity"	GO:0045153	other molecular functions
AT5G40810	AT5G40810	electron carrier activity	GO:0009055	other molecular functions
AT5G40810	AT5G40810	iron ion binding	GO:0005506	other binding
AT5G40810	AT5G40810	heme binding	GO:0020037	other binding

Gene Network Informations
Gene Network	Interact with..
FPTEVCPM079_E11_PDNR-F[interact with..]	Contig0889

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
Contig0889	1187	gb	ACJ38537.1	ascorbate peroxidase	Oncidium Gower Ramsey	249	440 bits (1132)	e-121	212/248 (85%)	225/248 (90%)	+3