Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPTEVCPM	FPTEVCPM017_A03_pDNR-F	1104

Contig Map:

(ProjectName=FPTEVCPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPTEVCPM017_A03_pDNR-F](Singleton Sequence)

FPTEVCPM017_A03_pDNR-F 1104  bases 
GGGGGAGCAGGTGGCTATCAAGAAGATTGCCAATGCTTTTGATAATAAGATAGATGCGAAGAGGACGCTGCGGGAGATTAAGCTGCTTCGTCATATGGATCATGAAAATGTTGTTGCAATCAGAGATATAATACCAGCACCAAGAAGGGAGGCATTCAATGATGTATACATTGCTTATGAACTTATGGACACTGATCTCCATCAGATAATTCGTTCAAATCAGTCTCTGTCAGAGGAGCACTGTCAGTATTTCCTATATCAGATCCTTCGTGGACTAAAATACATACATTCAGCTAGTGTTCTTCATAGAGATTTGAAGCCCAGCAACCTTCTACTGAATGCTAACTGTGATTTGAAAATATGCGACTTTGGATTGGCTCGCACTACATCAGAAACTGATTTCATGACGGAGTATGTTGTTACAAGATGGTACCGTGCACCAGAGCTTTTGTTAAATTCTTCAGAGTACACAACAGCAATTGACATGTGGTCGGTTGGCTGCATTTTTATGGAGCTAATGGACCGCAAGCCCTTATTTCCAGGACGAGACCACGTACATCAGTTACGCCTTTTGATGGAGCTCATAGGAACTCCTGATGAAGCTGATCTGGGGCATGTAAATGAGAACGCGAGAAGATACCTTAATCAGCTTCCTCACCATAGACCTCAATCATTTCCTGAAAAATTTCCTCGTGTTCATCCTCAAGCTATTGACCTTATTGAAAAAATGTTGACATTTGATCCTAGAAAGAGACTTACTGTTGAAGAAGCCCTGGAGCATCCTTATCTGGCTTTCCTTGCATGACATCAGCGACGAGCCAGTCTGCATGATGCCTTTCAGCTTTGACTTCGAGCAGCATGCTTTGTCGGAGGAGCAGATGAAGGAGCTAATATACCGTGAGGCCCTTGCCTTTACCCCGAGTATCAAATGATTAGATTTTTGTTTCTGCTCAGACGTGCTCATTTTCATCATTTTGTCTTTCTAGCTGTCTGCTGTCTCTGGTTTGTAGTCTGCGTCATCATGTTATATAGTTATTAGACTTGTTTGTACATTTGTCTGTGAATCTAATGGATGGAATTTGTTATGGCGATGTGCAAGTATCG

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	NP_001056846.1	Os06g0154500	Oryza sativa (japonica cultivar-group)	398	495 bits (1275)	e-155	241/266 (90%)	252/266 (94%)	+2

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[74 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Organismal Systems	Environmental Adaptation	04626	Plant-pathogen interaction	[PATH:ath04626]	FPTEVCPM017_A03_pDNR-F	AT2G43790	FPTEVCPM
Organismal Systems	Immune System	04650	Natural killer cell mediated cytotoxicity	[PATH:ath04650]	FPTEVCPM017_A03_pDNR-F	AT2G43790	FPTEVCPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT2G43790	AT2G43790	trans-Golgi network	GO:0005802	Golgi apparatus
AT2G43790	AT2G43790	trans-Golgi network	GO:0005802	other cytoplasmic components
AT2G43790	AT2G43790	trans-Golgi network	GO:0005802	other intracellular components
AT2G43790	AT2G43790	phragmoplast	GO:0009524	other cytoplasmic components
AT2G43790	AT2G43790	phragmoplast	GO:0009524	other intracellular components
AT2G43790	AT2G43790	preprophase band	GO:0009574	other cytoplasmic components
AT2G43790	AT2G43790	preprophase band	GO:0009574	other intracellular components
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	kinase activity
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	transferase activity
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	kinase activity
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	transferase activity
AT2G43790	AT2G43790	kinase activity	GO:0016301	kinase activity
AT2G43790	AT2G43790	response to cold	GO:0009409	response to stress
AT2G43790	AT2G43790	response to cold	GO:0009409	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	response to osmotic stress	GO:0006970	response to stress
AT2G43790	AT2G43790	response to osmotic stress	GO:0006970	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	response to oxidative stress	GO:0006979	response to stress
AT2G43790	AT2G43790	response to oxidative stress	GO:0006979	response to stress
AT2G43790	AT2G43790	phosphorylation	GO:0016310	other cellular processes
AT2G43790	AT2G43790	phosphorylation	GO:0016310	other metabolic processes
AT2G43790	AT2G43790	response to salt stress	GO:0009651	response to stress
AT2G43790	AT2G43790	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	signal transduction	GO:0007165	signal transduction
AT2G43790	AT2G43790	response to stress	GO:0006950	response to stress
AT2G43790	AT2G43790	"induced systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009864	response to stress
AT2G43790	AT2G43790	"induced systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009864	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	response to reactive oxygen species	GO:0000302	response to stress
AT2G43790	AT2G43790	response to abscisic acid stimulus	GO:0009737	other biological processes
AT2G43790	AT2G43790	response to ethylene stimulus	GO:0009723	other biological processes
AT2G43790	AT2G43790	response to hydrogen peroxide	GO:0042542	response to stress
AT2G43790	AT2G43790	defense response to bacterium	GO:0042742	response to stress
AT2G43790	AT2G43790	defense response to bacterium	GO:0042742	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	camalexin biosynthetic process	GO:0010120	other cellular processes
AT2G43790	AT2G43790	camalexin biosynthetic process	GO:0010120	other metabolic processes
AT2G43790	AT2G43790	root development	GO:0048364	developmental processes
AT2G43790	AT2G43790	ovule development	GO:0048481	developmental processes
AT2G43790	AT2G43790	cell division	GO:0051301	other cellular processes
AT2G43790	AT2G43790	trans-Golgi network	GO:0005802	Golgi apparatus
AT2G43790	AT2G43790	trans-Golgi network	GO:0005802	other cytoplasmic components
AT2G43790	AT2G43790	trans-Golgi network	GO:0005802	other intracellular components
AT2G43790	AT2G43790	phragmoplast	GO:0009524	other cytoplasmic components
AT2G43790	AT2G43790	phragmoplast	GO:0009524	other intracellular components
AT2G43790	AT2G43790	preprophase band	GO:0009574	other cytoplasmic components
AT2G43790	AT2G43790	preprophase band	GO:0009574	other intracellular components
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	kinase activity
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	transferase activity
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	kinase activity
AT2G43790	AT2G43790	MAP kinase activity	GO:0004707	transferase activity
AT2G43790	AT2G43790	kinase activity	GO:0016301	kinase activity
AT2G43790	AT2G43790	response to cold	GO:0009409	response to stress
AT2G43790	AT2G43790	response to cold	GO:0009409	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	response to osmotic stress	GO:0006970	response to stress
AT2G43790	AT2G43790	response to osmotic stress	GO:0006970	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	response to oxidative stress	GO:0006979	response to stress
AT2G43790	AT2G43790	response to oxidative stress	GO:0006979	response to stress
AT2G43790	AT2G43790	phosphorylation	GO:0016310	other cellular processes
AT2G43790	AT2G43790	phosphorylation	GO:0016310	other metabolic processes
AT2G43790	AT2G43790	response to salt stress	GO:0009651	response to stress
AT2G43790	AT2G43790	response to salt stress	GO:0009651	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	signal transduction	GO:0007165	signal transduction
AT2G43790	AT2G43790	response to stress	GO:0006950	response to stress
AT2G43790	AT2G43790	"induced systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009864	response to stress
AT2G43790	AT2G43790	"induced systemic resistance, jasmonic acid mediated signaling pathway"	GO:0009864	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	response to reactive oxygen species	GO:0000302	response to stress
AT2G43790	AT2G43790	response to abscisic acid stimulus	GO:0009737	other biological processes
AT2G43790	AT2G43790	response to ethylene stimulus	GO:0009723	other biological processes
AT2G43790	AT2G43790	response to hydrogen peroxide	GO:0042542	response to stress
AT2G43790	AT2G43790	defense response to bacterium	GO:0042742	response to stress
AT2G43790	AT2G43790	defense response to bacterium	GO:0042742	response to abiotic or biotic stimulus
AT2G43790	AT2G43790	camalexin biosynthetic process	GO:0010120	other cellular processes
AT2G43790	AT2G43790	camalexin biosynthetic process	GO:0010120	other metabolic processes
AT2G43790	AT2G43790	root development	GO:0048364	developmental processes
AT2G43790	AT2G43790	ovule development	GO:0048481	developmental processes
AT2G43790	AT2G43790	cell division	GO:0051301	other cellular processes

Gene Network Informations
Gene Network	Interact with..
FPTEVCPM017_A03_pDNR-F[interact with..]	FPTEVCPM085_F03_PDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FPTEVCPM085_F03_PDNR-F	1143	gb	ABR10070.1	MAPK	Malus hupehensis	373	605 bits (1560)	e-171	286/334 (85%)	314/334 (94%)	+1