Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FEVCP	FEVCPM029_D06_PDNR-F	1023

Contig Map:

(ProjectName=FEVCP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FEVCPM029_D06_PDNR-F](Singleton Sequence)

FEVCPM029_D06_PDNR-F 1023  bases 
GAAAGAATCTAATGTGCAGCCAAACACCGCCTAAAAATTCCTGAAACCCTCGACGACCAGAGCCACAAACTCGCGACGGGATCTCCCTGGAGAAGTTATCGTCTGGTGTCTGGTGCTGCGACGTGTGAAGAAGGAGATATCGTGAAGAAGGGCAGGAGTCCATATTTTGTTGGAATTCTCAGTGCAACCTAAAGGGCCGCTAGGGTTACAGAAGATAACGGAAAAATGTCGGGCCAGGGGCAGAGGCTGACCGTGGTGCCGACGGTGACGATGTTGGGCGTGATGAAGGCGCGGCTGGTCGGTGCGACCCGCGGCCACGCTCTCCTGAAGAAGAAGAGCGACGCCCTCACGGTTCAATTCCGCCAGATCCTTAAGAAAATAGTCTCCACAAAGGAGTCCATGGGGGACATCATGCGATCTTCCTCCTTCGCACTCACGGAGGCCAAGTACGCTGCCGGTGAAAACATTAAACACGTAGTCTTGGAGTCCGTTCGCTCTGCGTCAGTCAAGGTTCGTTCTCGGCAGGAGAACGTTGCAGGTGTGAAGCTCCCTAAGTTTGAACACTTCACTGACTCTGCTGCTGACTCCAAGTCTTCTACTGACCTCACTGGCCTTGCTCGTGGTGGACAGCAGGTCCAGGCCTGCCGTGCCGCACACATCAAGGCAATTGAGGTTCTTGTTGAACTTGCCTCTCTTCAGACCTCCTTTCTCACACTTGATGAGGCCATCAAGACTACCAACCGAAGGGTCAATGCGCTTGAGAATGTGGTCAAGCCCCGAATTGAGAATACAATCAGCTATATAAAGGGGGAACTTGACGAGCTAGAGAGAGAGGATTTCTCCAGGCTGAAGAAGATCCAGGGATATAAGAAGAGGGAGATAGAAAGGCAAACGCAGTCAGCTAAGCAGTTTGCAGAGAGAAGCGTGTGGAAGAGATTTCTCTGCAGAGGGATATCTTTCCATTCTGCACATATATGCTTGTTGCTGGGGCAGAGAAGATGAGGACATCATTTTTTAATGGAT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002523036.1	ATP synthase subunit d, putative	Ricinus communis	261	362 bits (928)	5e-98	197/250 (78%)	211/250 (84%), Gaps = 1/250 (0%)	+1

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[60 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04145	Phagosome	[PATH:ath04145]	FEVCPM029_D06_PDNR-F	AT3G58730	FEVCP
Metabolism	Energy Metabolism	00190	Oxidative phosphorylation	[PATH:ath00190]	FEVCPM029_D06_PDNR-F	AT3G58730	FEVCP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components

Gene Network Informations
Gene Network	Interact with..
FEVCPM029_D06_PDNR-F[interact with..]	Contig0151 FEVCPContig0557

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
Contig0151	809	gb	ACN50179.1	ubiquitin carrier-like protein	Annona cherimola	152	308 bits (790)	3e-82	145/152 (95%)	148/152 (97%)	+2
FEVCPContig0557	940	ref	XP_002282719.1	PREDICTED: hypothetical protein	Vitis vinifera	152	319 bits (818)	2e-85	151/152 (99%)	152/152 (100%)	+2