Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FEICP	EICPM022_E01_pDNR-F	1012

Contig Map:

(ProjectName=FEICP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[EICPM022_E01_pDNR-F](Singleton Sequence)

EICPM022_E01_pDNR-F 1012  bases 
GGCTGACCGTGGTGCCGACGGTGACGATGTTGGGCGTGATGAAGGCGCGGCTGGTCGGTGCGACCCGCGGCCACGCTCTCCTGAAGAAGAAGAGCGACGCCCTCACGGTTCAATTCCGCCAGATCCTTAAGAAAATAGTCTCCACAAAGGAGTCCATGGGGGACATCATGCGATCTTCCTCCTTCGCCCTCACGGAGGCCAAGTACGCTGCCGGTGAAAACATTAAACACGTAGTCTTGGAGTCCGTTCGCTCTGCGTCAGTCAAGGTTCGTTCTCGGCAGGAGAACGTTGCAGGTGTGAAGCTCCCTAAGTTTGAACACTTCACTGACTCTGCTGCTGACTCCAAGTCTTCTACTGACCTCACTGGCCTTGCTCGTGGTGGACAGCAGGTCCAGGCCTGCCGTGCCGCACACATCAAGGCAATTGAGGTTCTTGTTGAGCTTGCCTCTCTTCAGACCTCCTTTCTCACACTTGATGAGGCCATCAAGACTACCAACCGAAGGGTTAATGCGCTTGAGAATGTGGTCAAGCCCCGAATTGAGAATACAATCAGCTATATTAAGGGGGAACTTGACGAGCTAGAGAGAGAGGATTTCTTCAGGCTGAAGAAGATCCAGGGATATAAGAAGAGGGAGATAGAAAGGCAAACGCAGTCAGCTAAGCAGTTTGCAGAAGAGAAGCGTGTGGAAGAGATTTCTCTGCAGAAGGGGATATCTTTCCATTCTGCACATAATATGCTTGTTGCTGGGGCAGAGAAAGATGAGGACATCATTTTTTAATGGATACCTGATGCTTACTTGTTAGGTTGGATCCTGCAGCAGGCTAAAGTTGCAGCTTGTATTTTACTCTGTCATGGATGCTCGTCTCTGTAATCTGTATGGATTCTTTTCTAGCTGGGTTATGGCATGTATATTTTTATTTTCCAAATCTTTCAGACCAAACACACTTCAAATATTTCATTTATGTATATCGTCACTTATTGATGTGTCTACTTCATCGACATTCTGTATGA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002523036.1	ATP synthase subunit d, putative	Ricinus communis	261	389 bits (998)	e-106	209/258 (81%)	222/258 (86%)	+3

KEGG Pathway	GO
NoContigFind[2 Pathway]	NoContigFind[60 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04145	Phagosome	[PATH:ath04145]	EICPM022_E01_pDNR-F	AT3G58730	FEICP
Metabolism	Energy Metabolism	00190	Oxidative phosphorylation	[PATH:ath00190]	EICPM022_E01_pDNR-F	AT3G58730	FEICP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components
AT3G58730	AT3G58730	membrane	GO:0016020	other membranes
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	plasma membrane	GO:0005886	plasma membrane
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other cytoplasmic components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	vacuole	GO:0005773	other intracellular components
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	transport
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other cellular processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	other metabolic processes
AT3G58730	AT3G58730	ATP synthesis coupled proton transport	GO:0015986	electron transport or energy pathways
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other cytoplasmic components
AT3G58730	AT3G58730	plant-type vacuole	GO:0000325	other intracellular components
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	hydrolase activity
AT3G58730	AT3G58730	"ATPase activity, coupled to transmembrane movement of substances"	GO:0042626	transporter activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	hydrolase activity
AT3G58730	AT3G58730	"proton-transporting ATPase activity, rotational mechanism"	GO:0046961	transporter activity
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other membranes
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other cytoplasmic components
AT3G58730	AT3G58730	vacuolar membrane	GO:0005774	other intracellular components

Gene Network Informations
Gene Network	Interact with..
EICPM022_E01_pDNR-F[interact with..]	Contig2219 EICPS021_F07_pDNR-F Contig3208 Contig3407 EICPS006_E08_PDNR-F EICPS026_D01_pDNR-F EICPS026_D02_pDNR-F

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
Contig2219	1198	ref	XP_002509910.1	vacuolar ATP synthase subunit E, putative	Ricinus communis	230	367 bits (942)	1e-99	183/227 (80%)	207/227 (91%)	+2
EICPS021_F07_pDNR-F	883	ref	NP_001043767.1	Os01g0659200	Oryza sativa (japonica cultivar-group)	230	286 bits (733)	1e-75	142/181 (78%)	164/181 (90%)	+1
Contig3208	835	emb	CBI32005.1	unnamed protein product	Vitis vinifera	191	322 bits (824)	4e-86	153/153 (100%)	153/153 (100%)	+1
Contig3407	841	emb	CBI32005.1	unnamed protein product	Vitis vinifera	191	320 bits (821)	8e-86	153/160 (95%)	154/160 (96%)	+1
EICPS006_E08_PDNR-F	554	emb	CBI32005.1	unnamed protein product	Vitis vinifera	191	190 bits (483)	5e-47	91/93 (97%)	91/93 (97%)	+1
EICPS026_D01_pDNR-F	817	gb	ACN50179.1	ubiquitin carrier-like protein	Annona cherimola	152	308 bits (790)	3e-82	145/152 (95%)	148/152 (97%)	+1
EICPS026_D02_pDNR-F	871	gb	ACN50179.1	ubiquitin carrier-like protein	Annona cherimola	152	308 bits (790)	3e-82	145/152 (95%)	148/152 (97%)	+3