Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FAECPM	FAECPM012_E04_PDNRF	985

Contig Map:

(ProjectName=FAECPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FAECPM012_E04_PDNRF](Singleton Sequence)

FAECPM012_E04_PDNRF 985  bases 
AGAAAGGGCTCTTCAGCGTAATGCACTATCTCATGCCCAAGCGAGGCATACTCTCGCTGCACTCTGGATGCAATATGGGCAAGGACGGTGATGTCGCCCTCTTCTTTGGCCTCTCTGGCACTGGCAAGACGACTCTGTCTACTGACCACAACAGGTTGCTTATCGGTGATGACGAGCATTGCTGGAGCGATAATGGGGTTTCCAACATTGAAGGGGGTTGCTATGCGAAGTGCGTTGATCTTTCGCGTGAGAAGGAACCCGATATCTACAATGCGATTAAGTTTGGGACAGTGTTGGAGAATGTCGTGTTTGATGAGCACACTCGCGAAGTGGACTATAGTGATAAATCAGTAACAGAGAACACTCGAGCTTCCTACCCTATCGAGTACATTCCAAATGCGAAAATCCCTTGCGTGGGCCCACATCCTAAGAACGTCATACTCTTGGCCTGCGATGCTTTTGGAGTGCTTCCTCCCGTAAGCAAGCTAACCATGCCGCAGACAATGTACCACTTCATCACTGGCTACACCGCTCTGGTGGCGGGGACGGAGGATGGCATCAAGGAGCCGCAAGCCACCTTCTCTGCTTGCTTCGGTGCAGCATTCATCATGCTCCATCCCACCAAATACGCCGCCATGTTGGCTGACAAAATGAATAAGTTTGGCGCCACAGGTTGGCTTGTTAACACTGGCTGGTGCGGCGGAAGGTATGGAGTTGGGAGTCGCATAAAGTTGCCTTACACTCGCAGTATCATTAATGCCATCCATTCTGGTCAACTTCTGAATGCTGAGTACACCAAAACTGAGGTCTTTGGGCTGGAGATTCCTACTAAAGTTGAAGGAGTGCCTTCGGAGATCCTCAATCCTATGAATGCTTGGGAGGACAAGAAACACTACAAGGAAACTCTGTTAAAACTGGCCGGTTATTCAACAAGAATTTTGAGGTGTTCTCCAAATACAAAATCGGTTCAAGATACAAACTGACC

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
emb	CAR78944.1	phosphoenolpyruvate carboxykinase	Ichnanthus vicinus	499	552 bits (1422)	e-155	263/307 (85%)	278/307 (90%)	+3

KEGG Pathway	GO
NoContigFind[4 Pathway]	NoContigFind[108 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Metabolism	Carbohydrate Metabolism	00020	Citrate cycle (TCA cycle)	[PATH:ath00020]	FAECPM012_E04_PDNRF	AT4G37870	FAECPM
Metabolism	Carbohydrate Metabolism	00010	Glycolysis / Gluconeogenesis	[PATH:ath00010]	FAECPM012_E04_PDNRF	AT4G37870	FAECPM
Metabolism	Carbohydrate Metabolism	00620	Pyruvate metabolism	[PATH:ath00620]	FAECPM012_E04_PDNRF	AT4G37870	FAECPM
Metabolism	Energy Metabolism	00710	Carbon fixation in photosynthetic organisms	[PATH:ath00710]	FAECPM012_E04_PDNRF	AT4G37870	FAECPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT4G37870	AT4G37870	membrane	GO:0016020	other membranes
AT4G37870	AT4G37870	nucleolus	GO:0005730	nucleus
AT4G37870	AT4G37870	nucleolus	GO:0005730	other intracellular components
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase activity	GO:0004611	other enzyme activity
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	purine nucleotide binding	GO:0017076	nucleotide binding
AT4G37870	AT4G37870	response to cadmium ion	GO:0046686	other biological processes
AT4G37870	AT4G37870	cytosol	GO:0005829	cytosol
AT4G37870	AT4G37870	nucleus	GO:0005634	nucleus
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other cellular processes
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other metabolic processes
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	response to stress
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	other cellular processes
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT4G37870	AT4G37870	membrane	GO:0016020	other membranes
AT4G37870	AT4G37870	nucleolus	GO:0005730	nucleus
AT4G37870	AT4G37870	nucleolus	GO:0005730	other intracellular components
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase activity	GO:0004611	other enzyme activity
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	purine nucleotide binding	GO:0017076	nucleotide binding
AT4G37870	AT4G37870	response to cadmium ion	GO:0046686	other biological processes
AT4G37870	AT4G37870	cytosol	GO:0005829	cytosol
AT4G37870	AT4G37870	nucleus	GO:0005634	nucleus
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other cellular processes
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other metabolic processes
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	response to stress
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	other cellular processes
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT4G37870	AT4G37870	membrane	GO:0016020	other membranes
AT4G37870	AT4G37870	nucleolus	GO:0005730	nucleus
AT4G37870	AT4G37870	nucleolus	GO:0005730	other intracellular components
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase activity	GO:0004611	other enzyme activity
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	purine nucleotide binding	GO:0017076	nucleotide binding
AT4G37870	AT4G37870	response to cadmium ion	GO:0046686	other biological processes
AT4G37870	AT4G37870	cytosol	GO:0005829	cytosol
AT4G37870	AT4G37870	nucleus	GO:0005634	nucleus
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	membrane	GO:0016020	other membranes
AT4G37870	AT4G37870	nucleolus	GO:0005730	nucleus
AT4G37870	AT4G37870	nucleolus	GO:0005730	other intracellular components
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase activity	GO:0004611	other enzyme activity
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	purine nucleotide binding	GO:0017076	nucleotide binding
AT4G37870	AT4G37870	response to cadmium ion	GO:0046686	other biological processes
AT4G37870	AT4G37870	cytosol	GO:0005829	cytosol
AT4G37870	AT4G37870	nucleus	GO:0005634	nucleus
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other cellular processes
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other metabolic processes
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	response to stress
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	other cellular processes
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT4G37870	AT4G37870	membrane	GO:0016020	other membranes
AT4G37870	AT4G37870	nucleolus	GO:0005730	nucleus
AT4G37870	AT4G37870	nucleolus	GO:0005730	other intracellular components
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase activity	GO:0004611	other enzyme activity
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	purine nucleotide binding	GO:0017076	nucleotide binding
AT4G37870	AT4G37870	response to cadmium ion	GO:0046686	other biological processes
AT4G37870	AT4G37870	cytosol	GO:0005829	cytosol
AT4G37870	AT4G37870	nucleus	GO:0005634	nucleus
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other cellular processes
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other metabolic processes
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	response to stress
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	other cellular processes
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT4G37870	AT4G37870	membrane	GO:0016020	other membranes
AT4G37870	AT4G37870	nucleolus	GO:0005730	nucleus
AT4G37870	AT4G37870	nucleolus	GO:0005730	other intracellular components
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase activity	GO:0004611	other enzyme activity
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	purine nucleotide binding	GO:0017076	nucleotide binding
AT4G37870	AT4G37870	response to cadmium ion	GO:0046686	other biological processes
AT4G37870	AT4G37870	cytosol	GO:0005829	cytosol
AT4G37870	AT4G37870	nucleus	GO:0005634	nucleus
AT4G37870	AT4G37870	ATP binding	GO:0005524	nucleotide binding
AT4G37870	AT4G37870	phosphoenolpyruvate carboxykinase (ATP) activity	GO:0004612	other enzyme activity
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other cellular processes
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other metabolic processes
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	response to stress
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	other cellular processes
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other cellular processes
AT4G37870	AT4G37870	gluconeogenesis	GO:0006094	other metabolic processes
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	response to stress
AT4G37870	AT4G37870	cellular response to phosphate starvation	GO:0016036	other cellular processes
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT4G37870	AT4G37870	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus

Gene Network Informations
Gene Network	Interact with..
FAECPM012_E04_PDNRF[interact with..]	FAECPM012_E04_PDNRF

Query Name	Length of query	GenBank	Accession number(Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
FAECPM012_E04_PDNRF	985	emb	CAR78944.1	phosphoenolpyruvate carboxykinase	Ichnanthus vicinus	499	552 bits (1422)	e-155	263/307 (85%)	278/307 (90%)	+3