Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FPEAECP	FPEAECP015_C06_PDNR-F	1042

Contig Map:

(ProjectName=FPEAECP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FPEAECP015_C06_PDNR-F](Singleton Sequence)

FPEAECP015_C06_PDNR-F 1042  bases 
GTTACACTTCTTTTTCGTCCGTCTATGCCCGGGATTCGGCCTTACGGCCGGGGGGACAGCAGGTTACGAATAGGCGCTCAAACTTCTTCTTTCCTCCCTCGCGATAAGGTTGCAGATTGTAATGGCGCCTGTTCTGATAAGTGATGCGGTTGAATGGCAAGACTTGAAGAAACACGCGGAGGAGATAAAAAGAACGCACTTGCGTGATCTCATGGGTGATGTTGACCGTTGCAAGTTAATGACGACGGAGTATGATGGGATAATTTTGGACTACTCCCGGCAGTGTGCAGACCAGGAAACATTGGAGAAACTTTTTAAATTGGCAGAGGCAGCTCATCTGAAAGAGAAAATCAATAGAATGTACAATGGAGAGCATATAAACAGTACCGAGGACAGGTCTGTGCTGCATATTGCTTTGCGTGCTGCAAGGGATTCAGTTATTCATAGTGATGGGAGGAATGTTGTTCCAGATGTTTGGAATGTAATAGAGAAGATCAATGACTTCTCTGAAAGAGTTCGAAGTGGCTCATGGGTTGGAGCAACAGGAAAGACATTGAAGGACGTTGTAGCCGTGGGCATTGGTGGAAGCTTTCTTGGACCTTTGTTTGTGCATACTGCTCTTCAGACTGATCCTGAAGCCGCAGAATTTGTAAAGGGACGACAACTACGTTTCCTTGCGAATGTTGATCCGGTTGATGTGGCCCGAAACATTACTGGCTTGAATCCTGAAACAACATTGGTTGTTGTAGTTTCAAAAACTTTTACAACTGCTGAAACTATGTTGAATGCTCGAACATTGAGGGAATGGATTTCTGATGCGTTGGGCCAACAGGCAATAGCAAAGCATATGGTGGCTGTCAGTACAAATCTGAAGCTTGTGGAGGAATTTGGGATTGATCCGAATAATGCTTTTGCTTTTTGGGACTGGGTTGGTGGTCGCTATAGTGTTTGCAGTGCTGTTGCTGTGCTACCCTTGTCTCTCCATATGGGTTTTCCAGTCATTGAAAGTTTTTGGATGGAGCTTGTACCATTGACAATACTT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
gb	AAU00726.1	glucose-6-phosphate isomerase	Solanum tuberosum	568	478 bits (1229)	e-133	232/293 (79%)	263/293 (89%)	+2

KEGG Pathway	GO
NoContigFind[4 Pathway]	NoContigFind[66 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Metabolism	Carbohydrate Metabolism	00520	Amino sugar and nucleotide sugar metabolism	[PATH:ath00520]	FPEAECP015_C06_PDNR-F	AT5G42740	FPEAECP
Metabolism	Carbohydrate Metabolism	00010	Glycolysis / Gluconeogenesis	[PATH:ath00010]	FPEAECP015_C06_PDNR-F	AT5G42740	FPEAECP
Metabolism	Carbohydrate Metabolism	00030	Pentose phosphate pathway	[PATH:ath00030]	FPEAECP015_C06_PDNR-F	AT5G42740	FPEAECP
Metabolism	Carbohydrate Metabolism	00500	Starch and sucrose metabolism	[PATH:ath00500]	FPEAECP015_C06_PDNR-F	AT5G42740	FPEAECP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	response to cadmium ion	GO:0046686	other biological processes
AT5G42740	AT5G42740	cellular_component	GO:0005575	unknown cellular components
AT5G42740	AT5G42740	glucose-6-phosphate isomerase activity	GO:0004347	other enzyme activity
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other cellular processes
AT5G42740	AT5G42740	gluconeogenesis	GO:0006094	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other cellular processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	other metabolic processes
AT5G42740	AT5G42740	glycolysis	GO:0006096	electron transport or energy pathways
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to stress
AT5G42740	AT5G42740	"defense response to fungus, incompatible interaction"	GO:0009817	response to abiotic or biotic stimulus

Gene Network Informations
Gene Network	Interact with..
FPEAECP015_C06_PDNR-F[interact with..]	Not found!