Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FCTEVCP	FCTEVCPM068_G07_PDNR-F	1128

Contig Map:

(ProjectName=FCTEVCP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FCTEVCPM068_G07_PDNR-F](Singleton Sequence)

FCTEVCPM068_G07_PDNR-F 1128  bases 
CTGTTAGAAAAGGCACGAGTTTTGGAGCTCCATGCATCTTGGAGAACACATTGGCGGAAATGGTCATCTCTGCCGTTCCCAGTGTCGAGATGGTTCGGTTTGTTAACTCCGGAACCGGAGCATGCATGGGTGCTCTGCGTCTCGCCCGTGCCTTCACTGGCCGTCCGAAAATCATAAAATTTGAGGGCTGCTATCATGGTCATGCTGACTCGTTCCTCGTCAAAGCCGGCAGCGGTGTCGCCACCCTTGGCCTCCCTGACTCCCCCGGCGTCCCTAAGGCGGCTACTGCAGATACTCTAACTGCTCCATACAATGACATCGAATCCGTGAAGAATCTTTTTGAGAGCCATAAAGGCGAGATCGCTGCAGTGATAATCGAACCAGTTGTTGGAAATGCCGGATTCATCACGCCGAAGCCCGGTTTCCTGGAAGCCCTGCGCCAAATTACAGAGGAAGAAGATTCTCTTCTCATCTTCGATGAAGTCATGACCGGATTCCGACTTTCTTACGGTGGAGCTCAGGAGTATTTCGGCGTAACTCCCGATTTAACCACTTTGGGGAAGATTATCGGCGGCGGTTTACCTGTCGGTGCTTATGGAGGGAAGAGGAAAATCATGGAGATGGTGGCTCCTTCTGGTCCGATGTATCAGGCAGGAACTTTAAGTGGAAATCCATTAGCCATGACTGCTGGAATTCACACCCTTAGAAGGTTGCGAGAATCAGAGTGTTACGAGTACTTGGATGAGATCACCGGAAAGCTGATTTCAGGAATTCTGAAAGGCGGTAGAGATGCGGGACACGAGCTCTCCGGTGGCTATGTAGGAGGAATGTTTGGTTTTTTCTTCACAGAGGGGCCTGTATTTAATTATGAAAATGCAAAAAAAAGTGACACGACAAAATTTGCGAGGTTTCATAGGGGTATGCTGGAAGAATGTGTTTATCTTGCTCCATCCCAGTTTGAAGCAGATTTACAGCATAGCTCATACTTCTTCTGATATGAGAAACTATTGAGCTGCATTAAAGTTTTCAGAGCTATATTTGGGTAGTAGCTTGAAACCTGATCTGTGTCATCTACTTTCATTTTTCTGTATTTGTGTTTAGTAACTTGCTATGAGGTTTTATTTTGTT

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
emb	CAA46787.1	glutamate-1-semialdehyde 2,1-aminomutase	Nicotiana tabacum	478	483 bits (1244)	e-134	240/330 (72%)	270/330 (81%), Gaps = 3/330 (0%)	+3

KEGG Pathway	GO
NoContigFind[1 Pathway]	NoContigFind[66 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Metabolism	Metabo lism of Cofactors and Vitamins	00860	Porphyrin and chlorophyll metabolism	[PATH:ath00860]	FCTEVCPM068_G07_PDNR-F	AT3G48730	FCTEVCP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	plastid
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	plastid
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other intracellular components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other intracellular components
AT3G48730	AT3G48730	catalytic activity	GO:0003824	other enzyme activity
AT3G48730	AT3G48730	transaminase activity	GO:0008483	transferase activity
AT3G48730	AT3G48730	pyridoxal phosphate binding	GO:0030170	other binding
AT3G48730	AT3G48730	"glutamate-1-semialdehyde 2,1-aminomutase activity"	GO:0042286	other enzyme activity
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	plastid
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	chloroplast
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	other intracellular components
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	porphyrin biosynthetic process	GO:0006779	other cellular processes
AT3G48730	AT3G48730	porphyrin biosynthetic process	GO:0006779	other metabolic processes
AT3G48730	AT3G48730	"glutamate-1-semialdehyde 2,1-aminomutase activity"	GO:0042286	other enzyme activity
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	plastid
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	plastid
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other intracellular components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other intracellular components
AT3G48730	AT3G48730	catalytic activity	GO:0003824	other enzyme activity
AT3G48730	AT3G48730	transaminase activity	GO:0008483	transferase activity
AT3G48730	AT3G48730	pyridoxal phosphate binding	GO:0030170	other binding
AT3G48730	AT3G48730	"glutamate-1-semialdehyde 2,1-aminomutase activity"	GO:0042286	other enzyme activity
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	plastid
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	chloroplast
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	other intracellular components
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	porphyrin biosynthetic process	GO:0006779	other cellular processes
AT3G48730	AT3G48730	porphyrin biosynthetic process	GO:0006779	other metabolic processes
AT3G48730	AT3G48730	"glutamate-1-semialdehyde 2,1-aminomutase activity"	GO:0042286	other enzyme activity
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	plastid
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	plastid
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	chloroplast
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other intracellular components
AT3G48730	AT3G48730	chloroplast stroma	GO:0009570	other intracellular components
AT3G48730	AT3G48730	catalytic activity	GO:0003824	other enzyme activity
AT3G48730	AT3G48730	transaminase activity	GO:0008483	transferase activity
AT3G48730	AT3G48730	pyridoxal phosphate binding	GO:0030170	other binding
AT3G48730	AT3G48730	"glutamate-1-semialdehyde 2,1-aminomutase activity"	GO:0042286	other enzyme activity
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	plastid
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	chloroplast
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	other cytoplasmic components
AT3G48730	AT3G48730	chloroplast envelope	GO:0009941	other intracellular components
AT3G48730	AT3G48730	chloroplast	GO:0009507	chloroplast
AT3G48730	AT3G48730	porphyrin biosynthetic process	GO:0006779	other cellular processes
AT3G48730	AT3G48730	porphyrin biosynthetic process	GO:0006779	other metabolic processes
AT3G48730	AT3G48730	"glutamate-1-semialdehyde 2,1-aminomutase activity"	GO:0042286	other enzyme activity

Gene Network Informations
Gene Network	Interact with..
FCTEVCPM068_G07_PDNR-F[interact with..]	Not found!