Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FCTEVCP	FCTEVCPM059_F05_PDNR-F	1077

Contig Map:

(ProjectName=FCTEVCP
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FCTEVCPM059_F05_PDNR-F](Singleton Sequence)

FCTEVCPM059_F05_PDNR-F 1077  bases 
GAATCTACTTCACTTCCCTCACGCCTTCCCGAACCCGCGCGATACAGTCGCGATTAGGAATAACTGGGAAGGCAACGGCGGGATCGCGGCGTGCAGAGAACCGAAATTCCCATCTTTCTCTTCCATACGCTCCGCTCCTACCGGAAGACAATCAGACATTTTACAGTCGATGAAGGAGGATTTGTGGATCTGTGCATGCCCCCAGTGAGAGAAGAACCTCGTTGAAAGGAAAATTAGGACTTCAACATTCAGTCCTAATGGGTTCGGTGGATCTCAGTCGGATGCTTTTGTCCTCTGCTATCATTAGGCTGCTTTTGTTGATTTACGGGGAATGGCAGGATGCCCACTTGGAGGTCCGTTACACTGATGTTGACTACCTTGTATTTTCAGATGCGGCTACCATGGTAGCTGCTGGAAGGTCACCATATGAGAGATCCACTTACCGTTACTCTCCTCTTCTGGCTTTCTTGCTTGTACCCAACTCCTTCCTCCATCGATCATGGGGGAAGATGCTTTTCTCCGCATCTGATTTGCTGGTGGGATTATTTATTTACAGGATCTTGAGGCAGCGTGGTGTTTCTGAGAAAGTCTCACTTTGGTGCGTGGCTGCTCGGCTTTTCAACCCATTTACATTCACCATCGGCACCAGAGGAAATTGTAAGGTGTATCAGGCAGCTTTCTGGTACGGGCTCATCGTCCACTTCAGGATCTACCCAATCATATATAGCCTTCCGTTTGTTATAGTTATCAGCAGAATGGACATGGCTCCTGGAAAGCCAAACCTCAGCCAGTGGGTTCCAACGCTCAAAATCTTACCAGAAAGCTCTTCTTCAAATATCTGGTTTTTAGTGAGGGCCATATTCTCAAAAAACGCCATTTTATTTGGGCTGTTTTCTGGCTCCGTGTTCTTCGCATTTACTGCTATTTTCTTCCATATTATACGGATGGGAGTTTTTGAATGAAGCCCTCCTGTATCACCTGACTCGCACAGATCCTAGGCATAATTTCCCCATCTATTTCTACTATATTTATTTGCACCACCAGCAGGTTCTCCAGCCTTAGAAAAGCTCCTCCCTC

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
gb	AAT85302.1	mannosyltransferase (PIG-M) domain containing protein	Oryza sativa (japonica cultivar-group)	426	263 bits (671)	5e-86	129/204 (63%)	156/204 (76%), Gaps = 11/204 (5%)	+3

KEGG Pathway	GO
NoContigFind[1 Pathway]	NoContigFind[42 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Metabolism	Glycan Biosynthesis and Metabolism	00563	Glycosylphosphatidylinositol(GPI)-anchor biosynthesis	[PATH:ath00563]	FCTEVCPM059_F05_PDNR-F	AT5G22130	FCTEVCP

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	ER
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G22130	AT5G22130	integral to membrane	GO:0016021	other membranes
AT5G22130	AT5G22130	mannosyltransferase activity	GO:0000030	transferase activity
AT5G22130	AT5G22130	GPI anchor biosynthetic process	GO:0006506	protein metabolism
AT5G22130	AT5G22130	GPI anchor biosynthetic process	GO:0006506	other cellular processes
AT5G22130	AT5G22130	GPI anchor biosynthetic process	GO:0006506	other metabolic processes
AT5G22130	AT5G22130	cellulose biosynthetic process	GO:0030244	other cellular processes
AT5G22130	AT5G22130	cellulose biosynthetic process	GO:0030244	other metabolic processes
AT5G22130	AT5G22130	plant-type cell wall biogenesis	GO:0009832	cell organization and biogenesis
AT5G22130	AT5G22130	embryo development	GO:0009790	developmental processes
AT5G22130	AT5G22130	"transferase activity, transferring glycosyl groups"	GO:0016757	transferase activity
AT5G22130	AT5G22130	cell division	GO:0051301	other cellular processes
AT5G22130	AT5G22130	"alpha-1,4-mannosyltransferase activity"	GO:0051751	transferase activity
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	ER
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G22130	AT5G22130	integral to membrane	GO:0016021	other membranes
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	ER
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G22130	AT5G22130	integral to membrane	GO:0016021	other membranes
AT5G22130	AT5G22130	mannosyltransferase activity	GO:0000030	transferase activity
AT5G22130	AT5G22130	GPI anchor biosynthetic process	GO:0006506	protein metabolism
AT5G22130	AT5G22130	GPI anchor biosynthetic process	GO:0006506	other cellular processes
AT5G22130	AT5G22130	GPI anchor biosynthetic process	GO:0006506	other metabolic processes
AT5G22130	AT5G22130	cellulose biosynthetic process	GO:0030244	other cellular processes
AT5G22130	AT5G22130	cellulose biosynthetic process	GO:0030244	other metabolic processes
AT5G22130	AT5G22130	plant-type cell wall biogenesis	GO:0009832	cell organization and biogenesis
AT5G22130	AT5G22130	embryo development	GO:0009790	developmental processes
AT5G22130	AT5G22130	"transferase activity, transferring glycosyl groups"	GO:0016757	transferase activity
AT5G22130	AT5G22130	cell division	GO:0051301	other cellular processes
AT5G22130	AT5G22130	"alpha-1,4-mannosyltransferase activity"	GO:0051751	transferase activity
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	ER
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other membranes
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other cytoplasmic components
AT5G22130	AT5G22130	endoplasmic reticulum membrane	GO:0005789	other intracellular components
AT5G22130	AT5G22130	integral to membrane	GO:0016021	other membranes

Gene Network Informations
Gene Network	Interact with..
FCTEVCPM059_F05_PDNR-F[interact with..]	Not found!