Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FAECPM	FAECPM039_F12_PDNR-F	1046

Contig Map:

(ProjectName=FAECPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FAECPM039_F12_PDNR-F](Singleton Sequence)

FAECPM039_F12_PDNR-F 1046  bases 
GGCGCGAAAATATCGCCTATACTTTCCCATTCCCTCCCTCGGGCCCGAAACCCCATCCATTTTATAGTCGCGAGCGGTGAAGTCGCCATTGTAGCTCGGCAACGAGGGGATCGCATCGCGGTCTGCGAAGACATTCGAAACTCCACTCTTTGTCTGCTCCTAACCAAATACCGAATCCACTGAGGAAGGTTGGTGGAAGATCAAATTCTTTTGGAAGGTGATTTTTTTTTGAAGAAGCTTTGATGGCTCATACAACTACTGAAAAGAGAACATCTGTGTATATTTACATCCCAAATATTCTTGGTTATCTGAGAGTTCTGCTCAATATTGTTGCATTCGCTCTGTGCTTTTCCAGTAAATTTTGGTTTGCAAGCCTTTACTTCATTAGCTTTGTTTGTGATGGAGTAGATGGTTGGCTTGCACGGAAGTTTAATCAAGTATCAACCTTTGGGGCAGTTCTGGACATGGTAACAGACAGAGTGAGCACGGCTTGTTTATTGGCAATCCTCTCTCAACTTTACAGACCTGGCTTGATCTTTTTAGCATTGCTTGGATTAGATATTGCAAGCCACTGGCTGCAAATGTATAGTACTTTCTTGAGTGGCAAGAGCAGCCATAAAGATGTCAAGGACAAAAGTAGTTGGCTTTTAAGGGCATATTATCAGCATCGTTATCTCATGGCGTTCTGCTGTGTTGGATCTGAGGTTCTTTACATCATTCTTTTTTTAATTCATCAAAAGCACGATGAAAGTTTAATCTCTGTCTGTGTGAATTCTACAAAAATAGCTTAACCCTTTCAGTACTATTCACATTAGCATTTATTGGATGGGGAATTAAACAAATTGTGAATATCATTCAGATGAGACAGCTGCTGATGCGTGCGTGATATATGATATGAAGAAAGTGAGAGCCATGATCCTCCTCAAATGGCTGATTTAGTAGTTGTAGATAAAACTTATCCATGAGATATTTTAGTCGATTGAGATTTCTGCTTTCTTTAAATGTACGCTGACATGAGAATTACATCTGCAGTCGCATCTATGTAA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
ref	XP_002533188.1	phosphatidylinositol synthase, putative	Ricinus communis	227	244 bits (623)	5e-67	117/172 (68%)	136/172 (79%)	+3

KEGG Pathway	GO
NoContigFind[3 Pathway]	NoContigFind[32 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Environmental Information Processing	SignalTransduction	04070	Phosphatidylinositol signaling system	[PATH:ath04070]	FAECPM039_F12_PDNR-F	AT4G38570	FAECPM
Metabolism	Carbohydrate Metabolism	00562	Inositol phosphate metabolism	[PATH:ath00562]	FAECPM039_F12_PDNR-F	AT4G38570	FAECPM
Metabolism	Lipid Metabolism	00564	Glycerophospholipid metabolism	[PATH:ath00564]	FAECPM039_F12_PDNR-F	AT4G38570	FAECPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other cellular processes
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other metabolic processes
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other cellular processes
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other metabolic processes
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other cellular processes
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other metabolic processes
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other cellular processes
AT4G38570	AT4G38570	phosphatidylinositol biosynthetic process	GO:0006661	other metabolic processes
AT4G38570	AT4G38570	membrane	GO:0016020	other membranes
AT4G38570	AT4G38570	"phosphotransferase activity, for other substituted phosphate groups"	GO:0016780	transferase activity
AT4G38570	AT4G38570	endomembrane system	GO:0012505	other cellular components

Gene Network Informations
Gene Network	Interact with..
FAECPM039_F12_PDNR-F[interact with..]	Not found!