Contig View

Back [Phalaenopsis Transcriptome]

Library Name: Contig Lists:

Contig Information:

Project Name	Query Name	Length of query
FAECPM	FAECPM020_D11_PDNR-F	1011

Contig Map:

(ProjectName=FAECPM
SequenceName=NoContigFind):

Sequences View:[NoContigFind](Contig Seguence)

Sequences View:[FAECPM020_D11_PDNR-F](Singleton Sequence)

FAECPM020_D11_PDNR-F 1011  bases 
GGATAACATTATTGATAGAAGCATCCAAGATGCCTACATTCATGCAATCCGCCGAGCAAAGGATTTTATCTATATCGAAAATCAATATTTTCTTGGTAGCTGTTTTGGATGGAAGCCAGATGGTATCAAACCGGAGGAAATTGGGGCTTTACATCTTATTCCTAAGGAGCTTTCACTAAAGATTGTTAGTAAGATTGAAGCTGGGGAACGGTTTACGGTTTATGTTGTTGTTCCTATGTGGCCAGAAGGCGTTCCTGAAAGTGCTTCTGTTCAGGCAATTCTGGATTGGCAAAGGAGAACTATGGAAATGATGTATACTGATGTTACACTGGCCCTTCAGGCTAAAGGAATTGTAGCAAACCCCAAAGACTATCTGACATTCTTTTGCTTGGGGAATCGAGAGGTGCAGAAGAGCGGCGAATACACTCCTGAGGAGCAGCCTCAGCCTGACACTGATTATTATCGAGCGCAGCAGGCCAGGCGGTTTATGATTTATGTTCACGCCAAGATGATGATAGTTGACGACGAGTATATAATCATTGGATCTGCAAACATCAATCAGAGATCAATGGATGGAGCGAGGGACTCTGAGATTGCCATGGGCGCGTACCAGCCCAACTATCTGGCAGCACGGGAACCAGCCAGAGGCCAAATCCATGGCTTCCGGATGTCTCTTTGGTATGAGCACCTAGGCATGCTCGACGATGTCTTCCAACATCCCGAGAGTGTGGAGTGTGTGCAGAAAGTGAACAGGATTGCAGAAAAATACTGGGATTTGTACTCCAGCGAGACGCTTGAAAGAGACCTTCCGGGCCATCTCCTCAGCTACCCAGTTGGAGTCAGTGGTGACGGCGAGGTCACGGAGCTGCCGGGGACCGAATTCTTTCCGGACACGAAGCTCGTATCCTCGGCACCAGGGCGGACTACCTTCCCCAATTCTCACCACCTGAAAACACTGATCTATGTTTCTGTGGTTGTCCCTGTTCTTTTGTGCTGGTAGATATGGTAAAA

Contig Annotation:

GenBank	Accession number (Best hits in the GenBank)	Annotation	Species	Length of homologous protein(Amino Acid)	Score	Expect value	Identities	similarity	Frame
gb	ABY50100.1	phospholipase D	Agropyron mongolicum	570	543 bits (1400)	e-153	261/299 (87%)	280/299 (93%)	+2

KEGG Pathway	GO
NoContigFind[3 Pathway]	NoContigFind[92 GoTerm]

Pathway Informations
First-level terms	Second-level terms	KEGG pathway Num	KEGG pathway Name	KEGG pathway Description	contig Name	locusName	project Name
Cellular Processes	Transport and Catabolism	04144	Endocytosis	[PATH:ath04144]	FAECPM020_D11_PDNR-F	AT3G15730	FAECPM
Metabolism	Lipid Metabolism	00565	Ether lipid metabolism	[PATH:ath00565]	FAECPM020_D11_PDNR-F	AT3G15730	FAECPM
Metabolism	Lipid Metabolism	00564	Glycerophospholipid metabolism	[PATH:ath00564]	FAECPM020_D11_PDNR-F	AT3G15730	FAECPM

GO Informations
Locus Name	Go Name	Go Class Descriptions	GO id	Anotations01
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	response to cadmium ion	GO:0046686	other biological processes
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	mitochondrion	GO:0005739	mitochondria
AT3G15730	AT3G15730	nucleus	GO:0005634	nucleus
AT3G15730	AT3G15730	plasma membrane	GO:0005886	plasma membrane
AT3G15730	AT3G15730	"phosphatidylinositol-4,5-bisphosphate binding"	GO:0005546	other binding
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other cytoplasmic components
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other intracellular components
AT3G15730	AT3G15730	seed germination	GO:0009845	developmental processes
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	signal transduction
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	other cellular processes
AT3G15730	AT3G15730	regulation of stomatal movement	GO:0010119	other cellular processes
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	response to cadmium ion	GO:0046686	other biological processes
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	mitochondrion	GO:0005739	mitochondria
AT3G15730	AT3G15730	nucleus	GO:0005634	nucleus
AT3G15730	AT3G15730	plasma membrane	GO:0005886	plasma membrane
AT3G15730	AT3G15730	"phosphatidylinositol-4,5-bisphosphate binding"	GO:0005546	other binding
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other cytoplasmic components
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other intracellular components
AT3G15730	AT3G15730	seed germination	GO:0009845	developmental processes
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	signal transduction
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	other cellular processes
AT3G15730	AT3G15730	regulation of stomatal movement	GO:0010119	other cellular processes
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	response to cadmium ion	GO:0046686	other biological processes
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	mitochondrion	GO:0005739	mitochondria
AT3G15730	AT3G15730	nucleus	GO:0005634	nucleus
AT3G15730	AT3G15730	plasma membrane	GO:0005886	plasma membrane
AT3G15730	AT3G15730	"phosphatidylinositol-4,5-bisphosphate binding"	GO:0005546	other binding
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other cytoplasmic components
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other intracellular components
AT3G15730	AT3G15730	seed germination	GO:0009845	developmental processes
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	signal transduction
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	other cellular processes
AT3G15730	AT3G15730	regulation of stomatal movement	GO:0010119	other cellular processes
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	chloroplast	GO:0009507	chloroplast
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	response to cadmium ion	GO:0046686	other biological processes
AT3G15730	AT3G15730	membrane	GO:0016020	other membranes
AT3G15730	AT3G15730	mitochondrion	GO:0005739	mitochondria
AT3G15730	AT3G15730	nucleus	GO:0005634	nucleus
AT3G15730	AT3G15730	plasma membrane	GO:0005886	plasma membrane
AT3G15730	AT3G15730	"phosphatidylinositol-4,5-bisphosphate binding"	GO:0005546	other binding
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	phospholipase D activity	GO:0004630	hydrolase activity
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other cellular processes
AT3G15730	AT3G15730	fatty acid metabolic process	GO:0006631	other metabolic processes
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other cytoplasmic components
AT3G15730	AT3G15730	clathrin-coated vesicle	GO:0030136	other intracellular components
AT3G15730	AT3G15730	seed germination	GO:0009845	developmental processes
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	signal transduction
AT3G15730	AT3G15730	positive regulation of abscisic acid mediated signaling pathway	GO:0009789	other cellular processes
AT3G15730	AT3G15730	regulation of stomatal movement	GO:0010119	other cellular processes

Gene Network Informations
Gene Network	Interact with..
FAECPM020_D11_PDNR-F[interact with..]	Not found!