Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPTEVCPMContig1256936

Contig Map:
(ProjectName=FPTEVCPM
SequenceName=Contig1256):
GATTAGTAAATTCTCTGTAAGGTTCCCGTGGCATTGGAGCTAGGGTTTTAGGCGAGAGTTCGACGCAGGACGGCAGAAAGAACTTGGAAAAAAGCAAGAGTTTATCAGTAAGATGGCGGACGATGACTACAACGATATGGACATGGGGTATGAGGATGAGCCGCCGGAACCTGAAATTGAGGAAGGTGCAGAGGTAGAGGAAGATAACAATGATGATGTTCCAGATGATATTGTTGGTGTTGAAAATGAAGAAAAGGACCAAGAACCAGTTGAGAAACCTAGGAAAACATCCAAATATATGACAAAGTATGAGCGTGCAAGGATATTAGGCACACGTGCTCTTCAGATCAGCATGAATGCTCCTGTAATGGTTGAGCTTGAAGGTGAAACTGATCCTCTGGAGATTGCAATGAAAGAGCTTCGGCAGCGCAAGATACCCTTCACCATTCGAAGGTATCTTCCTGATGGGAGTTATGAGGACTGGGGAGTTGATGAGCTGATAGTAGAGGACTCCTGGAAGCGGCAGGTTGGTGGAGATTGAGATTAGCCAGCCTTCAAGCCTCCCAATGCATTGCTTCGGGATCTGCAACCGAAACACGTATCTCCTGTTTATAAACTTCGTGCTAAATTTCATGTTGAGCTATGAATGTATGTAGTGCAACTTTTGTCTATGTAGGGATTTTGAGCACAACTTTAGCACAACTTTGATTTATTGTTCATTACCGTTTCGAGATTTCCATGCATCCTTTTTATGAAGTGGTTGATATTATATAAATATGCTTAGGGAAATTTACATTGGTACAACACAATTCTTATGTATTTGTAAATCTAAAACCTAAATTTTGATGTTTATAACTATTGACACCTTGTTGCAATAAACATGGATAAATATATGTAATTGACTTTTAAAATGTTAATAAACCTGATTTTTTTTTT
FPTEVCPM083_G08_PDNR-F:GGGCATTGGAGCTAGGGTTTTAGGCGAGAGTTCGACGCAGGACGGCAGAAAGAACTTGGAAAAAAGCAAGAGTTTATCAGTAAGATGGCGGACGATGACTACAACGATATGGACATGGGGTATGAGGATGAGCCGCCGGAACCTGAAATTGAGGAAGGTGCAGAGGTAGAGGAAGATAACAATGATGATGTTCCAGATGATATTGTTGGTGTTGAAAATGAAGAAAAGGACCAAGAACCAGTTGAGAAACCTAGGAAAACATCCAAATATATGACAAAGTATGAGCGTGCAAGGATATTAGGCACACGTGCTCTTCAGATCAGCATGAATGCTCCTGTAATGGTTGAGCTTGAAGGTGAAACTGATCCTCTGGAGATTGCAATGAAAGAGCTTCGGCAGCGCAAGATACCCTTCACCATTCGAAGGTATCTTCCTGATGGGAGTTATGAGGACTGGGGAGTTGATGAGCTGATAGTAGAGGACTCCTGGAAGCGGCAGGTTGGTGGAGATTGAGATTAGCCAGCCTTCAAGCCTCCCAATGCATTGCTTCGGGATCTGCAACCGAAACACGTATCTCCTGTTTATAAACTTCGTGCTAAATTTCATGTTGAGCTATGAATGTATGTAGTGCAACTTTTGTCTATGTAGGGATTTTGAGCACAACTTTAGCACAACTTTGATTTATTGTTCATTACCGTTTCGAGATTTCCATGCATCCTTTTTATGAAGTGGTTGATATTATATAAATATGCTTAGGGAAATTTACATTGGTACAACACAATTCTTATGTATTTGTAAATCTAAAACCTAAATTTTGATGTTTATAACTATTGACACCTTGTTGCAATAAACATGGATAAATATATGTAATTGACTTTTAAAATGTTAATAAACCTGATTTTTTTTTT
FPTEVCPM022_D06_PDNR-F:GATTAGTAAATTCTCTGTAAGGTTCCCGTGGCATTGGAGCTAGGGTTTTAGGCGAGAGTTCGACGCAGGACGGCAGAAAGAACTTGGAAAAAAGCAAGAGTTTATCAGTAAGATGGCGGACGATGACTACAACGATATGGACATGGGGTATGAGGATGAGCCGCCGGAACCTGAAATTGAGGAAGGTGCAGAGGTAGAGGAAGATAACAATGATGATGTTCCAGATGATATTGTTGGTGTTGAAAATGAAGAAAAGGACCAAGAACCAGTTGAGAAACCTAGGAAAACATCCAAATATATGACAAAGTATGAGCGTGCAAGGATATTAGGCACACGTGCTCTTCAGATCAGCATGAATGCTCCTGTAATGGTTGAGCTTGAAGGTGAAACTGATCCTCTGGAGATTGCAATGAAAGAGCTTCGGCAGCGCAAGATACCCTTCACCATTCGAAGGTATCTTCCTGATGGGAGTTATGAGGACTGGGGAGTTGATGAGCTGATAGTAGAGGACTCCTGGAAGCGGCAGGTTGGTGGAGATTGAGATTAGCCAGCCTTCAAGCCTCCCAATGCATTGCTTCGGGATCTGCAACCGAAACACGTATCTCCTGTTTATAAACTTCGTGCTAAATTTCATGTTGAGCTATGAATGTATGTAGTGCAACTTTTGTCTATGTAGGGATTTTGAGCACAACTTTAGCACAACTTTGATTTATTGTTCATTACCGTTTCGAGATTTCCATGCATCCTTTTTATGAAGTGGTTGATATTATATAAATATGCTTAGGGAAATTTACATTGGTACAACACAATTCTTATGTATTTGTAAATCTAAAACCTAAATTTTGATGTCAA

Sequences View:[Contig1256](Contig Seguence)


Sequences View:[Contig1256](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
refXP_002318240.1 predicted protein Populus trichocarpa143204 bits (518)1e-50104/143 (72%)111/143 (77%), Gaps = 1/143 (0%) +2

KEGG PathwayGO
Contig1256[3 Pathway]Contig1256[56 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Genetic Information ProcessingTranscription03020RNA polymerase[PATH:ath03020]Contig1256AT5G51940FPTEVCPM
MetabolismNucleotide Metabolism00230Purine metabolism[PATH:ath00230]Contig1256AT5G51940FPTEVCPM
MetabolismNucleotide Metabolism00240Pyrimidine metabolism[PATH:ath00240]Contig1256AT5G51940FPTEVCPM

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418nucleus
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418nucleus
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418nucleus
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT5G51940AT5G51940"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418nucleus
AT5G51940AT5G51940DNA-directed RNA polymerase IV complexGO:0000418other intracellular components
AT5G51940AT5G51940DNA bindingGO:0003677DNA or RNA binding
AT5G51940AT5G51940DNA-directed RNA polymerase activityGO:0003899transferase activity
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351transcription
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other cellular processes
AT5G51940AT5G51940"transcription, DNA-dependent"GO:0006351other metabolic processes

Gene Network Informations
Gene NetworkInteract with..
Contig1256[interact with..]Contig0954
FPTEVCPM040_E09_PDNR-F
Contig1227
Contig1177
FPTEVCPM062_A08_PDNR-F
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
Contig09541045refXP_002285871.1 PREDICTED: similar to PBC1 (20S proteasome beta subunit C1); peptidase isoform 1 Vitis vinifera204381 bits (979)e-104183/204 (89%)201/204 (98%) +2
FPTEVCPM040_E09_PDNR-F1067refXP_002529996.1 DNA-directed RNA polymerase I subunit, putative Ricinus communis1159424 bits (1089)e-116207/299 (69%)244/299 (81%), Gaps = 1/299 (0%) +1
Contig12271210refXP_002441353.1 hypothetical protein SORBIDRAFT_09g025080 Sorghum bicolor267396 bits (1018)e-108197/265 (74%)221/265 (83%), Gaps = 7/265 (2%) +2
Contig11771261gbABE77393.4 EPSP synthase Allium macrostemon522598 bits (1542)e-174297/346 (85%)320/346 (92%) +1
FPTEVCPM062_A08_PDNR-F590refXP_002267800.1 PREDICTED: hypothetical protein Vitis vinifera51108 bits (270)3e-2249/51 (96%)49/51 (96%) +3