Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPTEVCPMContig10821071

Contig Map:
(ProjectName=FPTEVCPM
SequenceName=Contig1082):
GGTCAGAGCTCCTTGGTTGCTCCCAATCTCGAAGTAACCCTAGAAGATAGCCGTCGCTACTCGAATTGAAATGGCTCCGAAGAGAGGAGGTAAGGCACCGGTCGCGGGGAAAAAGAAGACGGAGAAGGTTGTGAATCCGTTATTTGAGAAGAGGCCGAAGCAGTTCGGGATTGGAGGTGCTCTACCTCCGAAGAGGGATTTACATCGTTTTGTCAAATGGCCTAAGGTGGTAAGAATTCAGAGGCAGAGGAGGATTCTTAAGCAGCGTCTGAAGGTTCCGCCAGCTATTAACCAGTTCACCAGGACCTTGGACAAGAATCTTGCAACAAGCCTGTTTAAGATGCTTTTGAAGTATAGGCCCGAGGACAAAGCTGCCAAGAAGGAACGACTTTTGAAGAGGGCGCAAGCTGAGACTGAAGGGAAGACAATTGAATCCAAGAAACCAATTGTTGTGAAATATGGGCTTAATCACGTCACTTACCTCATTGAGCAGAACAAGGCCCAATTGGTTGTTATTGCTCATGATGTTGATCCAATAGAACTGGTTGTTTGGCTTCCAGCATTGTGCAGGAAGATGGAAATCCCCTACTGCATAGTGAAGGGAAAGGCACGTTTGGGAACAATTGTTCACAAGAAGACTGCTGCTGTATTGTGCCTTACCACTGTGAAGAATGAAGATAAGCTCGAATTTAGCAAAATTTTAGAGGCTATTAAGGCCAACTTCAATGACAAGTTCGATGAGATCAGGAAAAAGTGGGGTGGCGGAATTATGGGTTCCAAATCTCAGGCCAAAAGTAAGGCAAAGGAAAAGCTCCTGGCTAAAGAAGCTGCTCAGAGGATGAGCTAGGCTGTTTTTCAACTTTTGAAATATGCATTATGGAGCTGTTTTGTTCTTTGATCCGTATTTTATTAGATTTTGATCTCCGTTGGTGGCTGCGTAGACTATGTTTTATGGACCGAAGGTTTTTTTTTTCACATACGTGTATTAACTATTTTATTCTGGGGCACAATTTTTCTGGTGAATCTACTTGCCTCCTTAGAACATAATTGCTTTGATAAGAAGTTCTTGGA
FPTEVCPM029_E01_PDNR-F:GGTCAGAGCTCCTTGGTTGCTCCCAATCTCGAAGTAACCCTAGAAGATAGCCGTCGCTACTCGAATTGAAATGGCTCCGAAGAGAGGAGGTAAGGCACCGGTCGCGGGGAAAAAGAAGACGGAGAAGGTTGTGAATCCGTTATTTGAGAAGAGGCCGAAGCAGTTCGGGATTGGAGGTGCTCTACCTCCGAAGAGGGATTTACATCGTTTTGTCAAATGGCCTAAGGTGGTAAGAATTCAGAGGCAGAGGAGGATTCTTAAGCAGCGTCTGAAGGTTCCGCCAGCTATTAACCAGTTCACCAGGACCTTGGACAAGAATCTTGCAACAAGCCTGTTTAAGATGCTTTTGAAGTATAGGCCCGAGGACAAAGCTGCCAAGAAGGAACGACTTTTGAAGAGGGCGCAAGCTGAGACTGAAGGGAAGACAATTGAATCCAAGAAACCAATTGTTGTGAAATATGGGCTTAATCACGTCACTTACCTCATTGAGCAGAACAAGGCCCAATTGGTTGTTATTGCTCATGATGTTGATCCAATAGAACTGGTTGTTTGGCTTCCAGCATTGTGCAGGAAGATGGAAATCCCCTACTGCATAGTGAAGGGAAAGGCACGTTTGGGAACAATTGTTCACAAGAAGACTGCTGCTGTATTGTGCCTTACCACTGTGAAGAATGAAGATAAGCTCGAATTTAGCAAAATTTTAGAGGCTATTAAGGCCAACTTCAATGACAAGTTCGATGAGATCAGGAAAAAGTGGGGTGGCGGAATTATGGGTTCCAAATCTCAGGCCAAAAGTAAGGCAAAGGAAAAGCTCCTGGCTAAAGAAGCTGCTCAGAGGATGAGCTAGGCTGTTTTTCAACTTTTGAAATATGCATTATGGAGCTGTTTTGTTCTTTGATCCGTATTTTATTAGATTTTGATCTCCGTTGGTGGCTGCGTAGACTATGTTTATGGACCGAAGGTTTTTTTTTCACATACGTGTATTAACTATTTTATTCTGGGGCACAATTTTTCTGTGAATCTACTTGCCTCCTTAGAACATAATTGCTTTGATAAGAAGTTCTTGGA
FPTEVCPM076_H06_PDNR-F:GAGAGCTCCTTGGTTGCTCCCAATCTCGAAGTAACCCTAGAAGATAGCCGTCGCTACTCGAATTGAAATGGCTCCGAAGAGAGGAGGTAAGGCACCGGTCGCGGGGAAAAAGAAGACGGAGAAGGTTGTGAATCCGTTATTTGAGAAGAGGCCGAAGCAGTTCGGGATTGGAGGTGCTCTACCTCCGAAGAGGGATTTACATCGTTTTGTCAAATGGCCTAAGGTGGTAAGAATTCAGAGGCAGAGGAGGATTCTTAAGCAGCGTCTGAAGGTTCCGCCAGCTATTAACCAGTTCACCAGGACCTTGGACAAGAATCTTGCAACAAGCCTGTTTAAGATGCTTTTGAAGTATAGGCCCGAGGACAAAGCTGCCAAGAAGGAACGACTTTTGAAGAGGGCGCAAGCTGAGACTGAAGGGAAGACAATTGAATCCAAGAAACCAATTGTTGTGAAATATGGGCTTAATCACGTCACTTACCTCATTGAGCAGAACAAGGCCCAATTGGTTGTTATTGCTCATGATGTTGATCCAATAGAACTGGTTGTTTGGCTTCCAGCATTGTGCAGGAAGATGGAAATCCCCTACTGCATAGTGAAGGGAAAGGCACGTTTGGGAACAATTGTTCACAAGAAGACTGCTGCTGTATTGTGCCTTACCACTGTGAAGAATGAAGATAAGCTCGAATTTAGCAAAATTTTAGAGGCTATTAAGGCCAACTTCAATGACAAGTTCGATGAGATCAGGAAAAAGTGGGGTGGCGGAATTATGGGTTCCAAATCTCAGCCAAAAGTAAGGCAAAGGAAAAGCTCCTGGCTAAAGAAGCTGCTCAGAGGATGAGCTAGGCTGTTTTTCAACTTTTGAAATATGCATTATGGAGCTGTTTTGTTCTTTGATCCGTATTTTATTAGATTTTGATCTCCGTTGGTGGCTGCGTAGACTATGTTTTATGGACCGAAGGTTTTTTTTTTCACATACGTGTATTAACTATTTTATTCTGGGGCACAATTTCTGGTGAATCGGA

Sequences View:[Contig1082](Contig Seguence)


Sequences View:[Contig1082](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
embCBI15705.1 unnamed protein product Vitis vinifera300377 bits (968)e-102190/237 (80%)195/237 (82%) +2

KEGG PathwayGO
Contig1082[1 Pathway]Contig1082[22 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Genetic Information ProcessingTranslation03010Ribosome[PATH:ath03010]Contig1082AT3G62870FPTEVCPM

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT3G62870AT3G62870membraneGO:0016020other membranes
AT3G62870AT3G62870plasma membraneGO:0005886plasma membrane
AT3G62870AT3G62870cytosolic ribosomeGO:0022626cytosol
AT3G62870AT3G62870cytosolic ribosomeGO:0022626cytosol
AT3G62870AT3G62870cytosolic ribosomeGO:0022626ribosome
AT3G62870AT3G62870cytosolic ribosomeGO:0022626ribosome
AT3G62870AT3G62870cytosolic ribosomeGO:0022626other cytoplasmic components
AT3G62870AT3G62870cytosolic ribosomeGO:0022626other cytoplasmic components
AT3G62870AT3G62870cytosolic ribosomeGO:0022626other intracellular components
AT3G62870AT3G62870cytosolic ribosomeGO:0022626other intracellular components
AT3G62870AT3G62870structural constituent of ribosomeGO:0003735structural molecule activity
AT3G62870AT3G62870translationGO:0006412protein metabolism
AT3G62870AT3G62870translationGO:0006412other cellular processes
AT3G62870AT3G62870translationGO:0006412other metabolic processes
AT3G62870AT3G62870cytosolic large ribosomal subunitGO:0022625cytosol
AT3G62870AT3G62870cytosolic large ribosomal subunitGO:0022625ribosome
AT3G62870AT3G62870cytosolic large ribosomal subunitGO:0022625other cytoplasmic components
AT3G62870AT3G62870cytosolic large ribosomal subunitGO:0022625other intracellular components
AT3G62870AT3G62870cytosolic ribosomeGO:0022626cytosol
AT3G62870AT3G62870cytosolic ribosomeGO:0022626ribosome
AT3G62870AT3G62870cytosolic ribosomeGO:0022626other cytoplasmic components
AT3G62870AT3G62870cytosolic ribosomeGO:0022626other intracellular components

Gene Network Informations
Gene NetworkInteract with..
Contig1082[interact with..]Contig0274
Contig0790
FPTEVCPM049_A08_PDNR-F
FPTEVCPM094_H07_pDNR-F
FPTEVCPM065_B07_PDNR-F
Contig0447
FPTEVCPM089_C12_PDNR-F
FPTEVCPM050_A02_PDNR-F
FPTEVCPM048_C04_PDNR-F
FPTEVCPM038_A02_PDNR-F
FPTEVCPM069_E08_PDNR-F
FPTEVCPM066_D02_PDNR-F
FPTEVCPM063_F01_PDNR-F
FPTEVCPM050_A09_PDNR-F
FPTEVCPM053_B04_PDNR-F
FPTEVCPM065_G10_PDNR-F
Contig0365
FPTEVCPM033_A03_PDNR-F
Contig0889
FPTEVCPM068_H09_PDNR-F
FPTEVCPM021_D07_pDNR-F
FPTEVCPM033_E10_PDNR-F
FPTEVCPM006_H11_PDNR-F
FPTEVCPM064_E04_PDNR-F
Contig0286
FPTEVCPM021_C09_pDNR-F
Contig1436
Contig1082
FPTEVCPM077_A09_PDNR-F
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
Contig0274546gbACJ38537.1 ascorbate peroxidase Oncidium Gower Ramsey24975.9 bits (185)2e-1243/80 (53%)45/80 (56%) +3
Contig07901193refXP_002284767.1 PREDICTED: ascorbate peroxidase Vitis vinifera250392 bits (1008)e-107193/250 (77%)207/250 (82%) +1
FPTEVCPM049_A08_PDNR-F481refXP_002531173.1 60S ribosomal protein L21, putative Ricinus communis164167 bits (422)5e-4080/86 (93%)83/86 (96%) +1
FPTEVCPM094_H07_pDNR-F776refXP_002531173.1 60S ribosomal protein L21, putative Ricinus communis164324 bits (830)6e-87152/164 (92%)160/164 (97%) +2
FPTEVCPM065_B07_PDNR-F1080refNP_001151429.1 LOC100285062 Zea mays281312 bits (799)1e-91146/210 (69%)179/210 (85%), Gaps = 2/210 (0%) +1
Contig04471120refNP_001148948.1 LOC100282568 Zea mays180277 bits (708)2e-72135/159 (84%)150/159 (94%) +2
FPTEVCPM089_C12_PDNR-F426refNP_001045607.1 Os02g0103700 Oryza sativa (japonica cultivar-group)192156 bits (394)8e-3776/85 (89%)85/85 (100%) +1
FPTEVCPM050_A02_PDNR-F623gbABO84840.1 putative MAPK2 Catharanthus roseus372195 bits (496)1e-4886/117 (73%)105/117 (89%) +1
FPTEVCPM048_C04_PDNR-F590gbAAM62469.1 acyl carrier protein, putative Arabidopsis thaliana126170 bits (431)6e-4184/93 (90%)91/93 (97%) +1
FPTEVCPM038_A02_PDNR-F1054refXP_002519577.1 Eukaryotic translation initiation factor 3 subunit, putative Ricinus communis222139 bits (351)4e-3182/162 (50%)100/162 (61%), Gaps = 3/162 (1%) +2
FPTEVCPM069_E08_PDNR-F920refXP_002304347.1 predicted protein Populus trichocarpa861390 bits (1002)e-106184/241 (76%)216/241 (89%) +2
FPTEVCPM066_D02_PDNR-F960refXP_002278126.1 PREDICTED: hypothetical protein Vitis vinifera235411 bits (1056)e-113209/223 (93%)217/223 (97%) +3
FPTEVCPM063_F01_PDNR-F1011refXP_002303970.1 predicted protein Populus trichocarpa358344 bits (882)1e-92177/244 (72%)202/244 (82%), Gaps = 5/244 (2%) +2
FPTEVCPM050_A09_PDNR-F999refXP_002324445.1 predicted protein Populus trichocarpa760372 bits (954)e-101174/234 (74%)212/234 (90%) +2
FPTEVCPM053_B04_PDNR-F1100refXP_002324445.1 predicted protein Populus trichocarpa760439 bits (1130)e-125207/277 (74%)245/277 (88%) +1
FPTEVCPM065_G10_PDNR-F977refNP_850025.1 PFK5 (PHOSPHOFRUCTOKINASE 5); 6-phosphofructokinase Arabidopsis thaliana537340 bits (871)2e-91156/197 (79%)179/197 (90%) +1
Contig03651305gbACF06450.1 ribosomal protein L10 Elaeis guineensis321488 bits (1256)e-136253/321 (78%)270/321 (84%) +3
FPTEVCPM033_A03_PDNR-F798refXP_002311621.1 predicted protein Populus trichocarpa133197 bits (501)1e-48102/123 (82%)107/123 (86%) +2
Contig08891187gbACJ38537.1 ascorbate peroxidase Oncidium Gower Ramsey249440 bits (1132)e-121212/248 (85%)225/248 (90%) +3
FPTEVCPM068_H09_PDNR-F687spQ9M4T8.1PSA5_SOYBN RecName: Full=Proteasome subunit alpha type-5; AltName: Full=20S proteasome alpha subunit E; AltName: Full=20S proteasome237248 bits (634)3e-64123/129 (95%)128/129 (99%) +1
FPTEVCPM021_D07_pDNR-F1067refXP_002301215.1 predicted protein Populus trichocarpa372338 bits (866)8e-91169/288 (58%)207/288 (71%), Gaps = 4/288 (1%) +3
FPTEVCPM033_E10_PDNR-F855refXP_002303818.1 predicted protein Populus trichocarpa605233 bits (595)1e-59114/150 (76%)132/150 (88%) +1
FPTEVCPM006_H11_PDNR-F865refXP_001757191.1 predicted protein Physcomitrella patens subsp. patens179141 bits (356)7e-3267/133 (50%)92/133 (69%), Gaps = 1/133 (0%) +1
FPTEVCPM064_E04_PDNR-F534refNP_190400.1 ALDH10A9; 3-chloroallyl aldehyde dehydrogenase/ oxidoreductase Arabidopsis thaliana503139 bits (349)1e-3156/70 (80%)64/70 (91%) +3
Contig02861288refXP_002523036.1 ATP synthase subunit d, putative Ricinus communis261399 bits (1026)e-109215/265 (81%)228/265 (86%) +2
FPTEVCPM021_C09_pDNR-F1107refXP_002326844.1 predicted protein Populus trichocarpa1166353 bits (906)2e-95186/302 (61%)233/302 (77%), Gaps = 3/302 (0%) +2
Contig14361006gbACG27794.1 proteasome subunit beta type 1 Zea mays221390 bits (1003)e-107186/221 (84%)205/221 (92%) +3
Contig10821071embCBI15705.1 unnamed protein product Vitis vinifera300377 bits (968)e-102190/237 (80%)195/237 (82%) +2
FPTEVCPM077_A09_PDNR-F1008gbACG47588.1 60S ribosomal protein L7a Zea mays255315 bits (806)6e-84155/199 (77%)165/199 (82%) +2