Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPTEVCPMContig0515842

Contig Map:
(ProjectName=FPTEVCPM
SequenceName=Contig0515):
GAATCTAGGGTTTACGGTTCTCCTCCTCGGCACCTAACGTGTTGCCGACGCCTACAAATATATCTCTCTTGTCCTATTTGAGTGTTCCCTTCCTGTGGAGGTCGAATCCAGCCGGCTGTAATCTCGAGCTCTGCGGCATCCTTCGGCTGCAGACATCCCCAAACTTCTTTCCACTTCACCATCAGAATTTATAGGCTAAAATGGTTGAGCTCCTGTTCGAGGATATCTTCACGGTGACCAGAATCGATCCTGATGGCAAAAAGTTCGATAAAGTGTCTAGGATTGAAGCACGGAGTGAGCAGTTTGATATGTACATGCAATTAGATGTGAATTCGGAGCTTTATCCACTTCATGTTGGGGAAAAATTCACAATGGTTCTTGCTTCAACTCTCAATTTCGATGGAACACCTGACTCCGGTTATTTCATGCAGGGACAGAAGAAGTCACTTGCAGACAAATATGAGTATGTTATGCATGGCAAACTCTATAAGATTTCAGAAGAGAGCGCCGGTGGCCCTGATATAAAAGTAGAGATTTATGTGTCATTTGGCGGTCTTCTAATGTTGCTGAAGGGGGATCCCTCAAATGCAGCCAACTTTGAACTGGACCAGAGGCTATTCCTACTCATTAGGAAAGTCTAATCAAACCTATATTTAGCCTTAATAATTAATTATTATTATGTAATTCTAAGATGAGAACAAACTTAGTGTTTATGGAAGGCTTCTTGAACTGTTGTTTTATGTAAATTTTGGTACCTTATATCTGTTGGTCATGCGTCTCTGCCTTTGCATTGGAAAATAGGGATCATGCTTTTATAAAAAAAAAAAAAAAAAAAAAAAAAA
FPTEVCPM029_G03_PDNR-F:GAATCTAGGGTTTACGGTTCTCCTCCTCGGCACCTAACGTGTTGCCGACGCCTACAAATATATCTCTCTTGTCCTATTTGAGTGTTCCCTTCCTGTGGAGGTCGAATCCAGCCGGCTGTAATCTCGAGCTCTGCGGCATCCTTCGGCTGCAGACATCCCCAAACTTCTTTCCACTTCACCATCAGAATTTATAGGCTAAAATGGTTGAGCTCCTGTTCGAGGATATCTTCACGGTGACCAGAATCGATCCTGATGGCAAAAAGTTCGATAAAGTGTCTAGGATTGAAGCACGGAGTGAGCAGTTTGATATGTACATGCAATTAGATGTGAATTCGGAGCTTTATCCACTTCATGTTGGGGAAAAATTCACAATGGTTCTTGCTTCAACTCTCAATTTCGATGGAACACCTGACTCCGGTTATTTCATGCAGGGACAGAAGAAGTCACTTGCAGACAAATATGAGTATGTTATGCATGGCAAACTCTATAAGATTTCAGAAGAGAGCGCCGGTGGCCCTGATATAAAAGTAGAGATTTATGTGTCATTTGGCGGTCTTCTAATGTTGCTGAAGGGGGATCCCTCAAATGCAGCCAACTTTGAACTGGACCAGAGGCTATTCCTACTCATTAGGAAAGTCTAATCAAACCTATATTTAGCCTTAATAATTAATTATTATTATGTAATTCTAAGATGAGAACAAACTTAGTGTTTATGGAAGGCTTCTTGAACTGTTGTTTTATGTAAATTTTGGTACCAAAAAAAAAAAAAAAAAAAAAAAAAA
FPTEVCPM046_H05_PDNR-F:GAGGGTTTACGGTTCTCCTCCTCGGCACCTAACGTGTTGCCGACGCCTACAAATATATCTCTCTTGTCCTATTTGAGTGTTCCCTTCCTGTGGAGGTCGAATCCAGCCGGCTGTAATCTCGAGCTCTGCGGCATCCTTCGGCTGCAGACATCCCCAAACTTCTTTCCACTTCACCATCAGAATTTATAGGCTAAAATGGTTGAGCTCCTGTTCGAGGATATCTTCACGGTGACCAGAATCGATCCTGATGGCAAAAAGTTCGATAAAGTGTCTAGGATTGAAGCACGGAGTGAGCAGTTTGATATGTACATGCAATTAGATGTGAATTCGGAGCTTTATCCACTTCATGTTGGGGAAAAATTCACAATGGTTCTTGCTTCAACTCTCAATTTCGATGGAACACCTGACTCCGGTTATTTCATGCAGGGACAGAAGAAGTCACTTGCAGACAAATATGAGTATGTTATGCATGGCAAACTCTATAAGATTTCAGAAGAGAGCGCCGGTGGCCCTGATATAAAAGTAGAGATTTATGTGTCATTTGGCGGTCTTCTAATGTTGCTGAAGGGGGATCCCTCAAATGCAGCCAACTTTGAACTGGACCAGAGGCTATTCCTACTCATTAGGAAAGTCTAATCAAACCTATATTTAGCCTTAATAATTAATTATTATTATGTAATTCTAAGATGAGAACAAACTTAGTGTTTATGGAAGGCTTCTTGAACTGTTGTTTTATGTAAATTTTGGTACCTTATATCTGTTGGTCATGCGTCTCTGCCTTTGCATTGGAAAATAGGGATCATGCTTTTAT

Sequences View:[Contig0515](Contig Seguence)


Sequences View:[Contig0515](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
gbACF06506.1 RNA polymerase Elaeis guineensis145262 bits (670)3e-68128/146 (87%)141/146 (96%) +3

KEGG PathwayGO
Contig0515[3 Pathway]Contig0515[20 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Genetic Information ProcessingTranscription03020RNA polymerase[PATH:ath03020]Contig0515AT3G59600FPTEVCPM
MetabolismNucleotide Metabolism00230Purine metabolism[PATH:ath00230]Contig0515AT3G59600FPTEVCPM
MetabolismNucleotide Metabolism00240Pyrimidine metabolism[PATH:ath00240]Contig0515AT3G59600FPTEVCPM

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT3G59600AT3G59600DNA-directed RNA polymerase activityGO:0003899transferase activity
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT3G59600AT3G59600DNA-directed RNA polymerase activityGO:0003899transferase activity
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT3G59600AT3G59600DNA-directed RNA polymerase activityGO:0003899transferase activity
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600transcriptionGO:0006350transcription
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665nucleus
AT3G59600AT3G59600"DNA-directed RNA polymerase II, core complex"GO:0005665other intracellular components
AT3G59600AT3G59600DNA-directed RNA polymerase activityGO:0003899transferase activity
AT3G59600AT3G59600transcriptionGO:0006350transcription

Gene Network Informations
Gene NetworkInteract with..
Contig0515[interact with..]Not found!