Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPTEVCPMContig0290515

Contig Map:
(ProjectName=FPTEVCPM
SequenceName=Contig0290):
AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGCAATCAGGGGTGAGATACAGAAGCTGGGCTCCTGATAGGCAGGAGAGGTTCATTCGTCGCTGGGTTGAGGCTTTGGGACATCCCAAGGTTAGCCATGAGCTCAGGAGTATCTGGGTCGGCTATCTGACTCAGTGCGACGCTACTCTGGGACAGAAGGTTGGCAGCAACCTCAATGTGAAGCCGAACATGTAATGATGTTAAATGTGAAGGCAAAGCAGACTAAGCACCCAATAAAGAATATGAGCTTCTTCAGCCCTTTAGAATAAGGCCAAGTACCATGTAGCCATCTTGATCATATAAGAAAGCTTCAATGCTTGAAGTTTCTTTGTTCTTGTTTGCTTTTGTGGTGTGGTTTGATAAATGAACAATGTTGGAATTAATCATGTAGAATATCCTTGGGCAATGCATTTGAGTGTAATAGTTGATTTTATGAATTTTTGTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
FPTEVCPM054_E02_PDNR-F:AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGCAATCAGGGGTGAGATACAGAAGCTGGGCTCCTGATAGGCAGGAGAGGTTCATTCGTCGCTGGGTTGAGGCTTTGGGACATCCCAAGGTTAGCCATGAGCTCAGGAGTATCTGGGTCGGCTATCTGACTCAGTGCGACGCTACTCTGGGACAGAAGGTTGGCAGCAACCTCAATGTGAAGCCGAACATGTAATGATGTTAAATGTGAAGGCAAAGCAGACTAAGCACCCAATAAAGAATATGAGCTTCTTCAGCCCTTTAGAATAAGGCCAAGTACCATGTAGCCATCTTGATCATATAAGAAAGCTTCAATGCTTGAAGTTTCTTTGTTCTTGTTTGCTTTTGTGGTGTGGTTTGATAAATGAACAATGTTGGAATTAATCATGTAGAATATCCTTGGGCACTGCATTTGAGTG
FPTEVCPM066_A06_PDNR-F:GGGACATCCCAAGGTTAGCCATGAGCTCAGGAGTATCTGGGTCGGCTATCTGACTCAGTGCGACGCTACTCTGGGACAGAAGGTTGGCAGCAACCTCAATGTGAAGCCGAACATGTAATGATGTTAAATGTGAAGGCAAAGCAGACTAAGCACCCAATAAAGAATATGAGCTTCTTCAGCCCTTTAGAATAAGGCCAAGTACCATGTAGCCATCTTGATCATATAAGAAAGCTTCAATGCTTGAAGTTTCTTTGTTCTTGTTTGCTTTTGTGGTGTGGTTTGATAAATGAACAATGTTGGAATTAATCATGTAGAATATCCTTGGGCAATGCATTTGAGTGTAATAGTTGATTTTATGAATTTTTGTTGGGCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
FPTEVCPM030_G08_PDNR-F:GAGCTCAGGAGTATCTGGGTCGGCTATCTGACTCAGTGCGACGCTACTCTGGGACAGAAGGTTGGCAGCAACCTCAATGTGAAGCCGAACATGTAATGATGTTAAATGTGAAGGCAAAGCAGACTAAGCACCCAATAAAGAATATGAGCTTCTTCAGCCCTTTAGAATAAGGCCAAGTACCATGTAGCCATCTTGATCATATAAGAAAGCTTCAATGCTTGAAGTTTCTTTGTTCTTGTTTGCTTTTGTGGTGTGGTTTGATAAATGAACAATGTTGGAATTAATCATGTAGAATATCCTTGGGCAATGCATTTGAGTGTAATAGTTGATTTTATGAATTTTTGTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
FPTEVCPM080_F11_PDNR-F:CTGGGTCGGCTATCTGACTCAGTGCGACGCTACTCTGGGACAGAAGGTTGGCAGCAACCTCAATGTGAAGCCGAACATGTAATGATGTTAAATGTGAAGGCAAAGCAGACTAAGCACCCAATAAAGAATATGAGCTTCTTCAGCCCTTTAGAATAAGGCCAAGTACCATGTAGCCATCTTGATCATATAAGAAAGCTTCAATGCTTGAAGTTTCTTTGTTCTTGTTTGCTTTTGTGGTGTGGTTTGATAAATGAACAATGTTGGAATTAATCATGTAGAATATCCTTGGGCAATGCATTTGAGTGTAATAGTTGATTTTATGAATTTTTGTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Sequences View:[Contig0290](Contig Seguence)


Sequences View:[Contig0290](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
gbACF06566.1 catalase 2 Elaeis guineensis492115 bits (287)2e-2450/63 (79%)56/63 (88%) +1

KEGG PathwayGO
Contig0290[2 Pathway]Contig0290[282 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Cellular ProcessesTransport and Catabolism04146Peroxisome[PATH:ath04146]Contig0290AT1G20620FPTEVCPM
MetabolismAmino Acid Metabolism00380Tryptophan metabolism[PATH:ath00380]Contig0290AT1G20620FPTEVCPM

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT1G20620AT1G20620mitochondrionGO:0005739mitochondria
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620response to coldGO:0009409response to stress
AT1G20620AT1G20620response to coldGO:0009409response to abiotic or biotic stimulus
AT1G20620AT1G20620response to light stimulusGO:0009416response to abiotic or biotic stimulus
AT1G20620AT1G20620cellular response to nitrogen starvationGO:0006995response to stress
AT1G20620AT1G20620cellular response to nitrogen starvationGO:0006995other cellular processes
AT1G20620AT1G20620cellular response to phosphate starvationGO:0016036response to stress
AT1G20620AT1G20620cellular response to phosphate starvationGO:0016036other cellular processes
AT1G20620AT1G20620cellular response to sulfate starvationGO:0009970response to stress
AT1G20620AT1G20620cellular response to sulfate starvationGO:0009970other cellular processes
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744response to stress
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744other cellular processes
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744other metabolic processes
AT1G20620AT1G20620cobalt ion bindingGO:0050897other binding
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620chloroplast stromaGO:0009570plastid
AT1G20620AT1G20620chloroplast stromaGO:0009570chloroplast
AT1G20620AT1G20620chloroplast stromaGO:0009570other cytoplasmic components
AT1G20620AT1G20620chloroplast stromaGO:0009570other intracellular components
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620chloroplast envelopeGO:0009941plastid
AT1G20620AT1G20620chloroplast envelopeGO:0009941chloroplast
AT1G20620AT1G20620chloroplast envelopeGO:0009941other cytoplasmic components
AT1G20620AT1G20620chloroplast envelopeGO:0009941other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620mitochondrionGO:0005739mitochondria
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620response to coldGO:0009409response to stress
AT1G20620AT1G20620response to coldGO:0009409response to abiotic or biotic stimulus
AT1G20620AT1G20620response to light stimulusGO:0009416response to abiotic or biotic stimulus
AT1G20620AT1G20620cellular response to nitrogen starvationGO:0006995response to stress
AT1G20620AT1G20620cellular response to nitrogen starvationGO:0006995other cellular processes
AT1G20620AT1G20620cellular response to phosphate starvationGO:0016036response to stress
AT1G20620AT1G20620cellular response to phosphate starvationGO:0016036other cellular processes
AT1G20620AT1G20620cellular response to sulfate starvationGO:0009970response to stress
AT1G20620AT1G20620cellular response to sulfate starvationGO:0009970other cellular processes
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744response to stress
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744other cellular processes
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744other metabolic processes
AT1G20620AT1G20620cobalt ion bindingGO:0050897other binding
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620chloroplast stromaGO:0009570plastid
AT1G20620AT1G20620chloroplast stromaGO:0009570chloroplast
AT1G20620AT1G20620chloroplast stromaGO:0009570other cytoplasmic components
AT1G20620AT1G20620chloroplast stromaGO:0009570other intracellular components
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620chloroplast envelopeGO:0009941plastid
AT1G20620AT1G20620chloroplast envelopeGO:0009941chloroplast
AT1G20620AT1G20620chloroplast envelopeGO:0009941other cytoplasmic components
AT1G20620AT1G20620chloroplast envelopeGO:0009941other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620mitochondrionGO:0005739mitochondria
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620catalase activityGO:0004096other enzyme activity
AT1G20620AT1G20620response to coldGO:0009409response to stress
AT1G20620AT1G20620response to coldGO:0009409response to abiotic or biotic stimulus
AT1G20620AT1G20620response to light stimulusGO:0009416response to abiotic or biotic stimulus
AT1G20620AT1G20620cellular response to nitrogen starvationGO:0006995response to stress
AT1G20620AT1G20620cellular response to nitrogen starvationGO:0006995other cellular processes
AT1G20620AT1G20620cellular response to phosphate starvationGO:0016036response to stress
AT1G20620AT1G20620cellular response to phosphate starvationGO:0016036other cellular processes
AT1G20620AT1G20620cellular response to sulfate starvationGO:0009970response to stress
AT1G20620AT1G20620cellular response to sulfate starvationGO:0009970other cellular processes
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744response to stress
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744other cellular processes
AT1G20620AT1G20620hydrogen peroxide catabolic processGO:0042744other metabolic processes
AT1G20620AT1G20620cobalt ion bindingGO:0050897other binding
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620chloroplast stromaGO:0009570plastid
AT1G20620AT1G20620chloroplast stromaGO:0009570chloroplast
AT1G20620AT1G20620chloroplast stromaGO:0009570other cytoplasmic components
AT1G20620AT1G20620chloroplast stromaGO:0009570other intracellular components
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620chloroplast envelopeGO:0009941plastid
AT1G20620AT1G20620chloroplast envelopeGO:0009941chloroplast
AT1G20620AT1G20620chloroplast envelopeGO:0009941other cytoplasmic components
AT1G20620AT1G20620chloroplast envelopeGO:0009941other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components
AT1G20620AT1G20620cell wallGO:0005618cell wall
AT1G20620AT1G20620chloroplastGO:0009507chloroplast
AT1G20620AT1G20620membraneGO:0016020other membranes
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other cytoplasmic components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620peroxisomeGO:0005777other intracellular components
AT1G20620AT1G20620plasma membraneGO:0005886plasma membrane
AT1G20620AT1G20620vacuoleGO:0005773other cytoplasmic components
AT1G20620AT1G20620vacuoleGO:0005773other intracellular components
AT1G20620AT1G20620response to cadmium ionGO:0046686other biological processes
AT1G20620AT1G20620apoplastGO:0048046extracellular
AT1G20620AT1G20620cytosolic ribosomeGO:0022626cytosol
AT1G20620AT1G20620cytosolic ribosomeGO:0022626ribosome
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other cytoplasmic components
AT1G20620AT1G20620cytosolic ribosomeGO:0022626other intracellular components

Gene Network Informations
Gene NetworkInteract with..
Contig0290[interact with..]Contig0379
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
Contig03791083gbACF06566.1 catalase 2 Elaeis guineensis492476 bits (1224)e-132219/248 (88%)232/248 (93%) +1