Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPTEVCPMContig09811185

Contig Map:
(ProjectName=FPTEVCPM
SequenceName=Contig0981):
AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGGGACTACTTTTCATTCCATCCAATCCCTCCTCTCTCCTCGATGGCCCTCCTCCGCCGCGTCGTCGCCTCGTTCACCATCCTGGCGGAGCGCACCGCCGTTACAACCATAGCAGCCCGCCTTGTTCCAACACAGCGGAATTCCTCGCAGGCGGAGCCTGCCTCATCGAAGACGAAGAAGATGAAGACGTTCTCGATCTACCGTTGGAATCCCGACAATCCGACGAAGCCGCAGCTCCGTGACTACGACTTGGATCTCAGCGAGTGCGGGCCGATGGTTCTCGATGCATTGATCAAGATAAAAAATGAGATGGATCCGAGCCTCACCTTTCGGCGATCGTGCCGCGAGGGGATCTGCGGTTCCTGCGCCATGAATATGGATGGAGACAATGGGCTGGCGTGCCTCACTAAGATCCGCTCGGAAAGCGGTACGGCAACTACGATCACGCCGCTGCCGCACATGTTTGTCATCAAGGATCTTGTGGTGGACATGACCAACTTCTACGCGCAGTATAAGAGCGTGGAACCGTGGCTGAAGCGCAAGGATCCGCCTGCAGTGCCGGGGAAGGAGAACCTCCAGAGCAAGAAGGATCGGGCGAAGCTGGATGGCATGTACGAGTGCATTCTTTGTGCTTGTTGTACCACGTCCTGCCCTAGCTACTGGTGGAACCCGGAGCCCTACCTTGGCCCGGCCGCCCTTCTACAGGCCAATAGATGGATTCAAGACAGCCGCGACCAGTATACAAAGGAACGTCTGGATGCCATTAATGATGAATTTAAACTGTATCGGTGCCATACCATAAAGAACTGTGTACACGCCTGTCCAAAGGGATTAAATCCTGCCAAGCAGATTGAATCAATTAAAAAGCTTCAGCTCAAGCAGTAGCTGCTCTTCATATGTTTTTTACCGACTCCAATTCCTCCGATCAAACCTGTATTTTCTCTGCAGCTTCTGCTGAAGCCCCGAATCTTATTGTTTGGGAAAATAAAAGGCTTTTATACTCTACTTTCTGAAAATAAGAGGCTATTCAGTCAGCTAATATGTTTGATGCTTTATGAAATGTGTGGTGAACAGCAGTTGTGTAGGTGGTCATCTTCTTTCTTTATTGAGATAATTATGAAAGCAAATAGTTAGAGAAATTACTTAC
FPTEVCPM027_A11_PDNR-F:AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGGGACTACTTTTCATTCCATCCAATCCCTCCTCTCTCCTCGATGGCCCTCCTCCGCCGCGTCGTCGCCTCGTTCACCATCCTGGCGGAGCGCACCGCCGTTACAACCATAGCAGCCCGCCTTGTTCCAACACAGCGGAATTCCTCGCAGGCGGAGCCTGCCTCATCGAAGACGAAGAAGATGAAGACGTTCTCGATCTACCGTTGGAATCCCGACAATCCGACGAAGCCGCAGCTCCGTGACTACGACTTGGATCTCAGCGAGTGCGGGCCGATGGTTCTCGATGCATTGATCAAGATAAAAAATGAGATGGATCCGAGCCTCACCTTTCGGCGATCGTGCCGCGAGGGGATCTGCGGTTCCTGCGCCATGAATATGGATGGAGACAATGGGCTGGCGTGCCTCACTAAGATCCGCTCGGAAAGCGGTACGGCAACTACGATCACGCCGCTGCCGCACATGTTTGTCATCAAGGATCTTGTGGTGGACATGACCAACTTCTACGCGCAGTATAAGAGCGTGGAACCGTGGCTGAAGCGCAAGGATCCGCCTGCAGTGCCGGGGAAGGAGAACCTCCAGAGCAAGAAGGATCGGGCGAAGCTGGATGGCATGTACGAGTGCATTCTTTGTGCTTGTTGTACCACGTCCTGCCCTAGCTACTGGTGGAACCCGGAGTCCTACCTTGGCCCGGCCGCCCTTCTACAGGCCAATAGATGGATTCAAGACAGCCGCGACCAGTATACAAAGGAACGTCTGGATGCCATTAATGATGAATTTAAACTGTATCGGTGCCATACCATAAAGAACTGTGTACACGCCTGTCAAAGGGATTAAATCCTGCCAAGCAGATTGAATCAATTAAAAAGCTTCAGCTCAAGCAGTAGCTGCTCTTCATATGTTTTTTACCGACTCCATTCCTCGATCAACCTGTATTTTCTCTGCAGCTTCTGCTGAAGCCCCGAATCTTATTGTTTGGGAAAATAAAAGGCTTTTATACTCTACTTTCTGAGAATAGA
FPTEVCPM084_F06_PDNR-F:GGGACTACTTTTCATTCCATCCAATCCCTCCTCTCTCCTCGATGGCCCTCCTCCGCCGCGTCGTCGCCTCGTTCACCATCCTGGCGGAGCGCACCGCCGTTACAACCATAGCAGCCCGCCTTGTTCCAACACAGCGGAATTCCTCGCAGGCGGAGCCTGCCTCATCGAAGACGAAGAAGATGAAGACGTTCTCGATCTACCGTTGGAATCCCGACAATCCGACGAAGCCGCAGCTCCGTGACTACGACTTGGATCTCAGCGAGTGCGGGCCGATGGTTCTCGATGCATTGATCAAGATAAAAAATGAGATGGATCCGAGCCTCACCTTTCGGCGATCGTGCCGCGAGGGGATCTGCGGTTCCTGCGCCATGAATATGGATGGAGACAATGGGCTGGCGTGCCTCACTAAGATCCGCTCGGAAAGCGGTACGGCAACTACGATCACGCCGCTGCCGCACATGTTTGTCATCAAGGATCTTGTGGTGGACATGACCAACTTCTACGCGCAGTATAAGAGCGTGGAACCGTGGCTGAAGCGCAAGGATCCGCCTGCAGTGCCGGGGAAGGAGAACCTCCAGAGCAAGAAGGATCGGGCGAAGCTGGATGGCATGTACGAGTGCATTCTTTGTGCTTGTTGTACCACGTCCTGCCCTAGCTACTGGTGGAACCCGGAGCCCTACCTTGGCCCGGCCGCCCTTCTACAGGCCAATAGATGGATTCAAGACAGCCGCGACCAGTATACAAAGGAACGTCTGGATGCCATTAATGATGAATTTAAACTGTATCGGTGCCATACCATAAAGAACTGTGTACACGCCTGTCCAAAGGGATTAAATCCTGCCAAGCAGATTGAATCAATTAAAAAGCTTCAGCTCAAGCAGTAGCTGCTCTTCATATGTTTTTTACCGACTCCAATTCCTCCGATCAAACCTGTATTTTCTCTGCAGCTTCTGCTGAAGCCCGAATCTTATTGTTTGGGAAAATAAAGGCTTTTATACTCTACTTTCTGAAAATAAGAGGCTATTCAGTCAGCTAATATGTTTGATGCTTTATGAAATGTGTGGTGAACAGCAGTTGTGTAGGTGGTCATCTCTCTTTATTGAGATAATTATGAGCAAATAGTTAGAGAAATTACTTAC
FPTEVCPM067_E08_PDNR-F:GGGACTACTTTTCATTCCATCCAATCCCTCCTCTCTCCTCGATGGCCCTCCTCCGCCGCGTCGTCGCCTCGTTCACCATCCTGGCGGAGCGCACCGCCGTTACAACCATAGCAGCCCGCCTTGTTCCAACACAGCGGAATTCCTCGCAGGCGGAGCCTGCCTCATCGAAGACGAAGAAGATGAAGACGTTCTCGATCTACCGTTGGAATCCCGACAATCCGACGAAGCCGCAGCTCCGTGACTACGACTTGGATCTCAGCGAGTGCGGGCCGATGGTTCTCGATGCATTGATCAAGATAAAAAATGAGATGGATCCGAGCCTCACCTTTCGGCGATCGTGCCGCGAGGGGATCTGCGGTTCCTGCGCCATGAATATGGATGGAGACAATGGGCTGGCGTGCCTCACTAAGATCCGCTCGGAAAGCGGTACGGCAACTACGATCACGCCGCTGCCGCACATGTTTGTCATCAAGGATCTTGTGGTGGACATGACCAACTTCTACGCGCAGTATAAGAGCGTGGAACCGTGGCTGAAGCGCAAGGATCCGCCTGCAGTGCCGGGGAAGGAGAACCTCCAGAGCAAGAAGGATCGGGCGAAGCTGGATGGCATGTACGAGTGCATTCTTTGTGCTTGTTGTACCACGTCCTGCCCTAGCTACTGGTGGAACCCGGAGCCCTACCTTGGCCCGGCCGCCCTTCTACAGGCCAATAGATGGATTCAAGACAGCCGCGACCAGTATACAAAGGAACGTCTGGATGCCATTAATGATGAATTTAAACTGTATCGGTGCCATACCATAAAGAACTGTGTACACGCCTGTCCAAAGGGATTAAATCCTGCCAAGCAGATTGAATCAATTAAAAAGCTTCAGCTCAAGCAGTAGCTGCTCTTCATATGTTTTTTACCGACTCCAATTCCTCCGATCAAACCTGTATTTTCTCTGCAGCTTCTGCTGAAGCCCCGAATCTTATTGTTTGGGAAAATAAAAGCTTTTTATACTCTACTTTCTGAAGATAAGAGGCTATCAGTCAGCTATATGTTTGATGCTTTATGAAATGTGTGGTGAACAGCAGTTGTGTAGTGGTCATCTTCTTTCTTTATTGAGATAATTATGAAAGCA

Sequences View:[Contig0981](Contig Seguence)


Sequences View:[FPTEVCPM027_A11_PDNR-F](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
embCAD62367.1 succinate dehydrogenase Triticum aestivum281437 bits (1125)e-121209/279 (74%)239/279 (85%), Gaps = 3/279 (1%) +3

KEGG PathwayGO
Contig0981[2 Pathway]Contig0981[40 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
MetabolismCarbohydrate Metabolism00020Citrate cycle (TCA cycle)[PATH:ath00020]Contig0981AT5G40650FPTEVCPM
MetabolismEnergy Metabolism00190Oxidative phosphorylation[PATH:ath00190]Contig0981AT5G40650FPTEVCPM

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650electron carrier activityGO:0009055other molecular functions
AT5G40650AT5G40650succinate dehydrogenase activityGO:0000104other enzyme activity
AT5G40650AT5G40650zinc ion bindingGO:0008270other binding
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other cellular processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other metabolic processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121electron transport or energy pathways
AT5G40650AT5G40650succinate dehydrogenase complexGO:0045281other intracellular components
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650electron carrier activityGO:0009055other molecular functions
AT5G40650AT5G40650succinate dehydrogenase activityGO:0000104other enzyme activity
AT5G40650AT5G40650zinc ion bindingGO:0008270other binding
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other cellular processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other metabolic processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121electron transport or energy pathways
AT5G40650AT5G40650succinate dehydrogenase complexGO:0045281other intracellular components
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650electron carrier activityGO:0009055other molecular functions
AT5G40650AT5G40650succinate dehydrogenase activityGO:0000104other enzyme activity
AT5G40650AT5G40650zinc ion bindingGO:0008270other binding
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other cellular processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other metabolic processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121electron transport or energy pathways
AT5G40650AT5G40650succinate dehydrogenase complexGO:0045281other intracellular components
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650mitochondrionGO:0005739mitochondria
AT5G40650AT5G40650electron carrier activityGO:0009055other molecular functions
AT5G40650AT5G40650succinate dehydrogenase activityGO:0000104other enzyme activity
AT5G40650AT5G40650zinc ion bindingGO:0008270other binding
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other cellular processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121other metabolic processes
AT5G40650AT5G40650"mitochondrial electron transport, succinate to ubiquinone"GO:0006121electron transport or energy pathways
AT5G40650AT5G40650succinate dehydrogenase complexGO:0045281other intracellular components

Gene Network Informations
Gene NetworkInteract with..
Contig0981[interact with..]Contig0290
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
Contig0290515gbACF06566.1 catalase 2 Elaeis guineensis492115 bits (287)2e-2450/63 (79%)56/63 (88%) +1