Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPTEVCPMContig02981135

Contig Map:
(ProjectName=FPTEVCPM
SequenceName=Contig0298):
GGAATCTGCTATTGCCGAAGATCGATTGCTTCCTCCTCAGCCCACTTTATATAAACTTCTTCCTCTACGGTTTCCTCCATTTCTCTCCGTTAGCTTCCATTCGTGCAGAGCGGAGGAGGAGGACGATCGGGTTCGCATTCTTTTTAATCTTCGCCAGTAATCATCTAGATCTGTTTGCGTACATCTCTTGATTGGGGGGAAGATGGGGCTTACGTTTACGAAGCTCTTTAGCCGTCTCTTTGCGAAGAGGGAGATGAGGATTTTAATGGTTGGTCTTGATGCCGCTGGTAAGACCACGATTCTCTACAAGCTGAAGCTCGGAGAGATTGTTACTACCATCCCAACTATTGGGTTCAATGTAGAGACTGTTGAGTACAAGAACATTAGCTTCACTGTTTGGGATGTTGGTGGTCAAGATAAGATCAGACCATTGTGGAGGCACTATTTCCAGAATACACAAGGCCTTATTTTTGTTGTTGACAGTAATGACAGAGATCGAGTCATTGAGGCCCGGGATGAGCTGCACAGAATGCTAAATGAGGATGAGCTGCGTGATGCTGTCTTGCTTGTGTTTGCAAACAAACAAGACCTGCCAAATGCTATGAATGCAGCCGAAATCACTGATAAGCTTGGTCTTCATTCGCTTCGTCAGCGACACTGGTACATTCAAAGCACTTGTGCCACCTCTGGTGAGGGCCTGTACGAGGGGCTCGACTGGCTTTCCAGCAACATTGCCAACAAGGGTTGAAACTTGTACTTTGATCAGAATACGCCGATTGTTCGTTTTCTATCCCTCTCGAGGAGTATTTTCTGACCTTTTCTTTTGCATCTAAGAGCACATATCCAATTAGTTGTAATGCAAAATCTTGTGTTGTGGTCTGATATTCTGTGTTTTTGTCTACTTGTCCTATTTGCACTGCAGTGTTGTTACAAATTCTATTTCTTTCCAGTGTTCCGTGCGTTTTATAATAGCTTTTATGTAGAGCACACACTCTGTTGAAGATTTTTAATTTTCTAGCATTATGTACAAGTATAAGGACTTCAGTTTTATTGAGCTTCTGTTTGAAAATTTTACATCATTCTGTTGAAATAAAGCTTGTCGTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
FPTEVCPM077_H02_PDNR-F:GGAATCTGCTATTGCCGAAGATCGATTGCTTCCTCCTCAGCCCACTTTATATAAACTTCTTCCTCTACGGTTTCCTCCATTTCTCTCCGTTAGCTTCCATTCGTGCAGAGCGGAGGAGGAGGACGATCGGGTTCGCATTCTTTTTAATCTTCGCCAGTAATCATCTAGATCTGTTTGCGTACATCTCTTGATTGGGGGGAAGATGGGGCTTACGTTTACGAAGCTCTTTAGCCGTCTCTTTGCGAAGAGGGAGATGAGGATTTTAATGGTTGGTCTTGATGCCGCTGGTAAGACCACGATTCTCTACAAGCTGAAGCTCGGAGAGATTGTTACTACCATCCCAACTATTGGGTTCAATGTAGAGACTGTTGAGTACAAGAACATTAGCTTCACTGTTTGGGATGTTGGTGGTCAAGATAAGATCAGACCATTGTGGAGGCACTATTTCCAGAATACACAAGGCCTTATTTTTGTTGTTGACAGTAATGACAGAGATCGAGTCATTGAGGCCCGGGATGAGCTGCACAGAATGCTAAATGAGGATGAGCTGCGTGATGCTGTCTTGCTTGTGTTTGCAAACAAACAAGACCTGCCAAATGCTATGAATGCAGCCGAAATCACTGATAAGCTTGGTCTTCATTCGCTTCGTCAGCGACACTGGTACATTCAAAGCACTTGTGCCACCTCTGGTGAGGGCCTGTACGAGGGGCTCGACTGGCTTTCCAGCAACATTGCCAACAAGGGTTGAAACTTGTACTTTGATCAGAATACGCCGATTGTTCGTTTTCTATCCCTCTCGAGGAGTATTTTCTGACCTTTTCTTTTGCATCTAAGAGCACATATCCAATTAGTTGTAATGCAAAATCTTGTGTTGTGGTCTGATATTCTGTGTTTTTGTCTACTTGTCCTATTTGCACTGCAGTGTTGTTACAAATTCTATTTCTTTCCAGTGTTCCGTGCGTTTTATAATAGCTTTTATGTAGAGCACACACTCTGTTGAAGATTTTTAATTTTCTAGCATTATGTACAAGTATAAGGACTTCAGTTTTATTGAGCTTCTGTTTGAAAATTTTAGAA
FPTEVCPM078_E05_PDNR-F:GATTTCTCTCCGTTAGCTTCCATTCGTGCAGAGCGGAGGAGGAGGACGATCGGGTTCGCATTCTTTTTAATCTTCGCCAGTAATCATCTAGATCTGTTTGCGTACATCTCTTGATTGGGGGGAAGATGGGGCTTACGTTTACGAAGCTCTTTAGCCGTCTCTTTGCGAAGAGGGAGATGAGGATTTTAATGGTTGGTCTTGATGCCGCTGGTAAGACCACGATTCTCTACAAGCTGAAGCTCGGAGAGATTGTTACTACCATCCCAACTATTGGGTACAATGTAGAGACTGTTGAGTACAAGAACATTAGCTTCACTGTTTGGGATGTTGGTGGTCAAGATAAGATCAGACCATTGTGGAGGCACTATTTCCAGAATACACAAGGCCTTATTTTTGTTGTTGACAGTAATGACAGAGATCGAGTCATTGAGGCCCGGGATGAGCTGCACAGAATGCTAAATGAGGATGAGCTGCGTGATGCTGTCTTGCTTGTGTTTGCAAACAAACAAGACCTGCCAAATGCTATGAATGCAGCCGAAATCACTGATAAGCTTGGTCTTCATTCGCTTCGTCAGCGACACTGGTACATTCAAAGCACTTGTGCCACCTCTGGTGAGGGCCTGTACGAGGGGCTCGACTGGCTTTCCAGCAACATTGCCAACAAGGGTTGAAACTTGTACTTTGATCAGAATACGCCGATTGTTCGTTTTCTATCCCTCTCGAGGAGTATTTTCTGACCTTTCCTTTTGCATCTAAGAGCACATATCCAATTAGTTGTAATGCAAAATCTTGTGTTGTGGTCTGATATTCTGTGTTTTTGTCTACTTGTCCTATTTGCACTGCAGTGTTGTTACAAATTCTATTTCTTTCCAGTGTTCCGTGCGTTTTATAATAGCTTTTATGTAGAGCACACACTCTGTTGAAGATTTTTAATTTTCTAGCATTATGTACAAGTATAAGGACTTCAGTTTTATTGAGCTTCTGTTC
FPTEVCPM081_E05_PDNR-F:TTAATGGTTGGTCTTGATGCCGCTGGTAAGACCACGATTCTCTACAAGCTGAAGCTCGGAGAGATTGTTACTACCATCCCAACTATTGGGTTCAATGTAGAGACTGTTGAGTACAAGAACATTAGCTTCACTGTTTGGGATGTTGGTGGTCAAGATAAGATCAGACCATTGTGGAGGCACTATTTCCAGAATACACAAGGCCTTATTTTTGTTGTTGACAGTAATGACAGAGATCGAGTCATTGAGGCCCGGGATGAGCTGCACAGAATGCTAAATGAGGATGAGCTGCGTGATGCTGTCTTGCTTGTGTTTGCAAACAAACAAGACCTGCCAAATGCTATGAATGCAGCCGAAATCACTGATAAGCTTGGTCTTCATTCGCTTCGTCAGCGACACTGGTACATTCAAAGCACTTGTGCCACCTCTGGTGAGGGCCTGTACGAGGGGCTCGACTGGCTTTCCAGCAACATTGCCAACAAGGGTTGAAACTTGTACTTTGATCAGAATACGCCGATTGTTCGTTTTCTATCCCTCTCGAGGAGTATTTTCTGACCTTTTCTTTTGCATCTAAGAGCACATATCCAATTAGTTGTAATGCAAAATCTTGTGTTGTGGTCTGATATTCTGTGTTTTTGTCTACTTGTCCTATTTGCACTGCAGTGTTGTTACAAATTCTATTTCTTTCCAGTGTTCCGTGCGTTTTATAATAGCTTTTATGTAGAGCACACACTCTGTTGAAGATTTTTAATTTTCTAGCATTATGTACAAGTATAAGGACTTCAGTTTTATTGAGCTTCTGTTTGGAA
FPTEVCPM004_B07_pDNR-F:GATAAGCTTGGTCTTCATTCGCTTCGTCAGCGACACTGGTACATTCAAAGCACTTGTGCCACCTCTGGTGAGGGCCTGTACGAGGGGCTCGACTGGCTTTCCAGCAACATTGCCAACAAGGGTTGAAACTTGTACTTTGATCAGAATACGCCGATTGTTCGTTTTCTATCCCTCTCGAGGAGTATTTTCTGACCTTTTCTTTTGCATCTAAGAGCACATATCCAATTAGTTGTAATGCAAAATCTTGTGTTGTGGTCTGATATTCTGTGTTTTTGTCTACTTGTCCTATTTGCACTGCAGTGTTGTTACAAATTCTATTTCTTTCCAGTGTTCCGTGCGTTTTATAATAGCTTTTATGTAGAGCACACACTCTGTTGAAGATTTTTAATTTTCTAGCATTATGTACAAGTATAAGGACTTCAGTTTTATTGAGCTTCTGTTTGAAAATTTTACATCATTCTGTTGAAATAAAGCTTGTCGTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Sequences View:[Contig0298](Contig Seguence)


Sequences View:[FPTEVCPM004_B07_pDNR-F](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
gbACF06579.1 ADP-ribosylation factor Elaeis guineensis181362 bits (929)4e-98177/180 (98%)180/180 (100%) +2

KEGG PathwayGO
No HitNo Hit


Gene Network Informations
Gene NetworkInteract with..
No HitNot found!