Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FPEAECPContig0062883

Contig Map:
(ProjectName=FPEAECP
SequenceName=Contig0062):
TTTTCGTCAAAACCTCCCCTTCGTCCCCGAGCCCTCGCGATACAGTCGCAACTGGTAACGCAAAGTTGGGATTGCGGCTTACAGAGATCCGAAACTCTCGCTTTGTTCCTCCTCCTCTCCTAACCGAAACCATTGAGGAAGGAAAAACAAGCAGCGCTTTGAAATCTTAGGTCAGAAGGGATGGTGCTCAAGACTGAACTTTGCCGATTTAGTGGTGCTAAGATTTACCCTGGAAAGGGTATCAGATTTGTTCGAGGCGACTCCCAGGTCTTTCTTTTTTCAAACTCAAAATGCAAACGATATTTTCACAACCGGCTGAAACCTGCCAAACTTACCTGGACAGCAATGTACAGGAAACAGCACAAGAAGGACATTCATGATGAATCTGTGAAGAAAAGGCGTCGTGCTACTAAGAAGCCTCTCTCCAGGTCAATTGTCGGCGCGTCCTTGGAGGTCATTCAAAAGAAAAGAACTGAGAAGCCTGAAGTTCGTGATGCTGCCAGAGAAGCAGCTCTGCGCGAAATAAAGGGGCGGATAAAGAAGACCAAGGATGAGAAGAAGGCCAAGAAGGCTGAGGCTTTAGCCAAAACGCAGAAGACCCAGACTAAGGGTAATGTGCTCAGGGGTTCCAAGGGACCAAAGCTTGGTGGTGGTGGTGGGAAGCGTTGAGGACTTGATATCCATAATTATATTCTTCTTTCTTAGTTTTCATGTGATCAGAAATATTCTCCTGAATTTGATGTTTTGCTTTGTTTAAACTTTATGGCTGCTTTATTGTGTTCTAAGTGGGATATGATTTTAGCTCTAAATTTGCTTCTTTTGGTCTGTTATGGGATTTTGGAAGCTTTATTATTATTATCATGTATTCTTCTTTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
FPEAECP045_A08_PDNR-F:TTTTCGTCAAAACCTCCCCTTCGTCCCCGAGCCCTCGCGATACAGTCGCAACTGGTAACGCAAAGTTGGGATTGCGGCTTACAGAGATCCGAAACTCTCACTTTGTTCCTCCTCCTCTCCTAACCGAAACCATTGAGGAAGGAAAAACAAGCAGCGCTTTGAAATCTTAGGTCAGAAGGGATGGTGCTCAAGACTGAACTTTGCCGATTTAGTGGTGCTAAGATTTACCCTGGAAAGGGTATTAGATTTGTTCGAGGCGACTCCCAGGTCTTTCTTTCTTCAAACTCAAAATGCAAACGATATTTTCACAACCGGCTGAAACCTGCCAAACTTACCTGGACAGCAATGTACAGGAAACAGCACAAGAAGGACATTCATGATGAATCTGTGAAGAAAAGGCGTCGTGCTACTAAGAAGCCTCTCTCCAGGTCAATTGTCGGCGCGTCCTTGGAGGTCATTCAAAAGAAAAGAACTGAGAAGCCTGAAGTTCGTGATGCTGCCAGAGAAGCAGCTCTGCGTGAAATAAAGGAGCGGATAAAGAAGACCAAGGATGAGAAGAAGGCCAAGAAGGCTGAGGCTTTAGCCAAAACGCAGAAGACCCAGACTAAGGGTAACGTGCTCAAGGGTTCCAAGGGACCAAAGCTCGGTGGTGGTGGTGGGAAGCGTTGAGGACTTGATATCCATAATTATATTCTTCTTTCTTAGTTTTCATGTGATCAGAAATATTCTCCTGAATTCGATGTTTTGCTTTGGTTAAACTTTATGGCTGCTTTATTGTGTTCTAAGTGGGATATGATTTTAGCTCTTAATTTTCTTCTTTTGGTCCGA
FPEAECP036_G03_PDNR-F:TTTCGTCAAAACCTCCCCTTCGTCCCCGAGCCCTCGCGATACAGTCGCAACTGGTAACGCAAAGTTGGGATTGCGGCTTACAGAGATCCGAAACTCTCGCTTTGTTCCTCCTCCTCTCCTAACCGAAACCATTGAGGAAGGAAAAACAAGCAGCGCTTTGAAATCTTAGGTCAGAAGGGATGGTGCTCAAGACTGAACTTTGCCGATTTAGTGGTGCTAAGATTTACCCTGGAAAGGGTATCAGATTTGTTCGAGGCGACTCCCAGGTCTTTCTTTTTTCAAACTCAAAATGCAAACGATATTTTCACAACCGGCTGAAACCTGCCAAACTTACCTGGACAGCAATGTACAGGAAACAGCACAAGAAGGACATTCATGATGAATCTGTGAAGAAAAGGCGTCGTGCTACTAAGAAGCCTCTCTCCAGGTCAATTGTCGGCGCGTCCTTGGAGGTCATTCAAAAGAAAAGAACTGAGAAGCCTGAAGTTCGTGATGCTGCCAGAGAAGCAGCTCTGCGCGAAATAAAGGGGCGGATAAAGAAGACCAAGGATGAGAAGAAGGCCAAGAAGGCTGAGGCTTTAGCCAAAACGCAGAAGACCCAGACTAAGGGTAATGTGCTCAGGGGTTCCAAGGGACCAAAGCTTGGTGGTGGTGGTGGGAAGCGTTGAGGACTTGATATCCATAATTATATTCTTCTTTCTTAGTTTTCATGTGATCAGAAATATTCTCCTGAATTTGATGTTTTGCTTTGTTTAAACTTTATGGCTGCTTTATTGTGTTCTAAGTGGGATATGATTTTAGCTCTAAATTTGCTTCTTTTGGTCTGTTATGGGATTTTGGAAGCTTTATTATTATTATCATGTATTCTTCTTTGAC
FPEAECP034_G10_PDNR-F:TTTCGTCAAAACCTCCCCTTCGTCCCCGAGCCCTCGCGATACAGTCGCAACTGGTAACGCAAAGTTGGGATTGCGGCTTACAGAGATCCGAAACTCTCGCTTTGTTCCTCCTCCTCTCCTAACCGAAACCATTGAGGAAGGAAAAACAAGCAGCGCTTTGAAATCTTAGGTCAGAAGGGATGGTGCTCAAGACTGAACTTTGCCGATTTAGTGGTGCTAAGATTTACCCTGGAAAGGGTATCAGATTTGTTCGAGGCGACTCCCAGGTCTTTCTTTTTTCAAACTCAAAATGCAAACGATATTTTCACAACCGGCTGAAACCTGCCAAACTTACCTGGACAGCAATGTACAGGAAACAGCACAAGAAGGACATTCATGATGAATCTGTGAAGAAAAGGCGTCGTGCTACTAAGAAGCCTCTCTCCAGGTCAATTGTCGGCGCGTCCTTGGAGGTCATTCAAAAGAAAAGAACTGAGAAGCCTGAAGTTCGTGATGCTGCCAGAGAAGCAGCTCTGCGCGAAATAAAGGGGCGGATAAAGAAGACCAAGGATGAGAAGAAGGCCAAGAAGGCTGAGGCTTTAGCCAAAACGCAGAAGACCCAGACTAAGGGTAATGTGCTCAGGGGTTCCAAGGGACCAAAGCTTGGTGGTGGTGGTGGGAAGCGTTGAGGACTTGATATCCATAATTATATTCTTCTTTCTTAGTTTTCATGTGATCAGAAATATTCTCCTGAATTTGATGTTTTGCTTTGTTTAAACTTTATGGCTGCTTTATTGTGTTCTAAGTGGGATATGATTTTAGCTCTAAATTTGCTTCTTTTGGTCTGTTATGGGATTTTGGAAGCTTTATTATTATTATCATGTATTCTTCTTTGACA
FPEAECP029_B07_PDNR-F:TTTCGTCAAAACCTCCCCTTCGTCCCCGAGCCCTCGCGATACAGTCGCAACTGGTAACGCAAAGTTGGGATTGCGGCTTACAGAGATCCGAAACTCTCGCTTTGTTCCTCCTCCTCTCCTAACCGAAACCATTGAGGAAGGAAAAACAAGCAGCGCTTTGAAATCTTAGGTCAGAAGGGATGGTGCTCAAGACTGAACTTTGCCGATTTAGTGGTGCTAAGATTTACCCTGGAAAGGGTATCAGATTTGTTCGAGGCGACTCCCAGGTCTTTCTTTTTTCAAACTCAAAATGCAAACGATATTTTCACAACCGGCTGAAACCTGCCAAACTTACCTGGACAGCAATGTACAGGAAACAGCACAAGAAGGACATTCATGATGAATCTGTGAAGAAAAGGCGTCGTGCTACTAAGAAGCCTCTCTCCAGGTCAATTGTCGGCGCGTCCTTGGAGGTCATTCAAAAGAAAAGAACTGAGAAGCCTGAAGTTCGTGATGCTGCCAGAGAAGCAGCTCTGCGCGAAATAAAGGGGCGGATAAAGAAGACCAAGGATGAGAAGAAGGCCAAGAAGGCTGAGGCTTTAGCCAAAACGCAGAAGACCCAGACTAAGGGTAATGTGCTCAGGGGTTCCAAGGGACCAAAGCTTGGTGGTGGTGGTGGGAAGCGTTGAGGACTTGATATCCATAATTATATTCTTCTTTCTTAGTTTTCATGTGATCAGAAATATTCTCCTGAATTTGATGTTTTGCTTTGTTTAAACTTTATGGCTGCTTTATTGTGTTCTAAGTGGGATATGATTTTAGCTCTAAATTTGCTTCTTTTGGTCTGTTATGGGATTTTGGAAGCTTTATTATTATTATCATGTATTCTTCTTTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Sequences View:[Contig0062](Contig Seguence)


Sequences View:[Contig0062](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
refNP_001150133.1 60S ribosomal protein L24 Zea mays161222 bits (566)3e-56110/119 (92%)113/119 (94%) +1

KEGG PathwayGO
Contig0062[1 Pathway]Contig0062[15 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Genetic Information ProcessingTranslation03010Ribosome[PATH:ath03010]Contig0062AT3G53020FPEAECP

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT3G53020AT3G53020nucleolusGO:0005730nucleus
AT3G53020AT3G53020nucleolusGO:0005730other intracellular components
AT3G53020AT3G53020structural constituent of ribosomeGO:0003735structural molecule activity
AT3G53020AT3G53020ribosomeGO:0005840ribosome
AT3G53020AT3G53020structural constituent of ribosomeGO:0003735structural molecule activity
AT3G53020AT3G53020translationGO:0006412protein metabolism
AT3G53020AT3G53020translationGO:0006412other cellular processes
AT3G53020AT3G53020translationGO:0006412other metabolic processes
AT3G53020AT3G53020ribosome biogenesisGO:0042254cell organization and biogenesis
AT3G53020AT3G53020auxin mediated signaling pathwayGO:0009734other biological processes
AT3G53020AT3G53020gynoecium developmentGO:0048467developmental processes
AT3G53020AT3G53020cytosolic large ribosomal subunitGO:0022625cytosol
AT3G53020AT3G53020cytosolic large ribosomal subunitGO:0022625ribosome
AT3G53020AT3G53020cytosolic large ribosomal subunitGO:0022625other cytoplasmic components
AT3G53020AT3G53020cytosolic large ribosomal subunitGO:0022625other intracellular components

Gene Network Informations
Gene NetworkInteract with..
Contig0062[interact with..]FPEAECP026_D12_PDNR-F
FPEAECP005_G01_PDNR-F
Contig0294
FPEAECP033_E12_PDNR-F
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
FPEAECP026_D12_PDNR-F818gbACG47565.1 60S ribosomal protein L17 Zea mays171293 bits (749)2e-77144/152 (94%)147/152 (96%) +3
FPEAECP005_G01_PDNR-F764gbABA40430.1 ribosomal protein L27a-like protein Solanum tuberosum148259 bits (663)1e-67124/149 (83%)129/149 (86%) +3
Contig02941056gbACF06468.1 40S ribosomal protein S5 Elaeis guineensis195355 bits (911)4e-96179/195 (91%)188/195 (96%) +1
FPEAECP033_E12_PDNR-F1004refNP_187967.1 60S ribosomal protein L7 (RPL7D) Arabidopsis thaliana244369 bits (946)e-100183/244 (75%)201/244 (82%) +3