Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FEVCPContig0454944

Contig Map:
(ProjectName=FEVCP
SequenceName=Contig0454):
GAAGCAAGCACTCGCCTCCAACTGGAATGGCCTCCGCCACTCTCTCCACTGCCGCTTGCCCTTCTCAGCTGTGCTCCAGCAAAAATGGAATATATGCACCATCGCAGGCTCTGCTCTACAAGCCAACAAAAGGGCTGGGCTCCGAGAAGGACCGGAGAATGAAGATTGCATGTCAGGCCACAAGCATTTCAGCTGATAGGGTTCCAGACATGGGAAAGAGGAAGCTCTTGAACCTTCTTCTTCTTGGAACCATTTCATTGCCAACGGCAGGGATGTTGTTTCCCTATGCCGCTTTCTTTGTCCCTCCCGGTGGGTCGGGTGGTGGCAGTGGAACTTATGCTAAAGATGCTCTTGGAAACGATGTTTTGGTAGATCAATGGCTCCAAACTCATGGACCTGGTGATAGAACTCTCACTCAGGGATTAAAGGGAGATCCTACTTATCTAGTTGTTGAGGCAGATAGATCTCTTGCAACATATGGCATCAATGCTGTGTGCACCCACCTTGGTTGTGTTGTCCCATGGAATTCGGCTGAGAACAAATTCATCTGTCCCTGCCACGGATCCCAGTATAACTACCAAGGCAAGGTTGTTAGAGGACCTGCCCCTTTGTCATTGGCATTGGCTCATGCGGATATAGACGATGGGAAGGTTTTATTTGTGCCCTGGCTAGAAACTGATTTCAGAACTGGTGAAGATCCCTGGTGGTCTTGAATTCTCTCTATAAACTCTTCTTCAGCAAAGACAAACAGCAGGAACAAATCTGAATGTTTGAATATTCTGTCTTTGAAGTAAAATAAAAAAAATAATAATAAAAAAAACATTCTTTTCGCCAAGTTCATGGTGTTGTATTATATCCGTGAAGAACAATGCTAGGAACTATGTTCAAATAATTTAAAAATTGGTAAAAAATGAATGTTCTGCTTGCAGCTGAAAAAAAAAAAA
FEVCPM006_E05_PDNRF:GAAGCAAGCACTCGCCTCCAACTGGAATGGCCTCCGCCACTCTCTCCACTGCCGCTTGCCCTTCTCAGCTGTGCTCCAGCAAAAATGGAATATATGCACCATCGCAGGCTCTGCTCTACAAGCCAACAAAAGGGCTGGGCTCCGAGAAGGACCGGAGAATGAAGATTGCATGTCAGGCCACAAGCATTTCAGCTGATAGGGTTCCAGACATGGGAAAGAGGAAGCTCTTGAACCTTCTTCTTCTTGGAACCATTTCATTGCCAACGGCAGGGATGTTGTTTCCCTATGCCGCTTTCTTTGTCCCTCCCGGTGGGTCGGGTGGTGGCAGTGGAACTTATGCTAAAGATGCTCTTGGAAACGATGTTTTGGTAGATCAACGGCTCCAAACTCATGGACCTGGTGATAGAACTCTCACTCAGGGATTAAAGGGAGATCCTACTTATCTAGTTGTTGAGGCAGATAGATCTCTTGCAACATATGGCATCAATGCTGTGTGCACCCACCTTGGTTGTGTTGTCCCATGGAATTCGGCTGAGAACAAATTCATCTGTCCCTGCCACGGATCCCAGTATAACTACCAAGGCAAGGTTGTTAGAGGACCTGCCCCTTTGTCATTGGCATTGGCTCATGCGGATATAGACGATGGGAAGGTTTTATTTGTGCCCTGGCTAGAAACTGATTTCAGAACTGGTGAAGATCCCTGGTGGTCTTGAATTCTCTCTATAAACTCTTCTTCAGCAAAGACAAACAGCAGGAACAAATCTGAATGTTTGAATATTCTGTCTTTGAAGTAAAATAAAAAAAATAATAATAAAAAAAACATTCTTTCGCCAAGTTCATGGTGTTGTATTATATCCGTGAAGAACAATGCTAGGAACTATGTTCAAATAATTTAAAAATTGGTAAAAAATGAATGTTCTGCTTGTGAAAAAA
FEVCPS004_D04_PDNRF:GGGCTGGGCTCCGAGAAGGACCGGAGAATGAAGATTGCATGTCAGGCCACAAGCATTTCAGCTGATAGGGTTCCAGACATGGGAAAGAGGAAGCTCTTGAACCTTCTTCTTCTTGGAACCATTTCATTGCCAACGGCAGGGATGTTGTTTCCCTATGCCGCTTTCTTTGTCCCTCCCGGTGGGTCGGGTGGTGGCAGTGGAACTTATGCTAAAGATGCTCTTGGAAACGATGTTTTGGTAGATCAATGGCTCCAAACTCATGGACCTGGTGATAGAACTCTCACTCAGGGATTAAAGGGAGATCCTACTTATCTAGTTGTTGAGGCAGATAGATCTCTTGCAACATATGGCATCAATGCTGTGTGCACCCACCTTGGTTGTGTTGTCCCATGGAATTCGGCTGAGAACAAATTCATCTGTCCCTGCCACGGATCCCAGTATAACTACCAAGGCAAGGTTGTTAGAGGACCTGCCCCTTTGTCATTGGCATTGGCTCATGCGGATATAGACGATGGGAAGGTTTTATTTGTGCCCTGGCTAGAAACTGATTTCAGAACTGGTGAAGATCCCTGGTGGTCTTGAATTCTCTCTATAAACTCTTCTTCAGCAAAGACAAACAGCAGGAACAAATCTGAATGTTTGAATATTCTGTCTTTGAAGTAAA
FEVCPM009_F11_PDNRF:ATGTCAGGCCACAAGCATTTCAGCTGATAGGGTTCCAGACATGGGAAAGAGGAAGCTCTTGAACCTTCTTCTTCTTGGAACCATTTCATTGCCAACGGCAGGGATGTTGTTTCCCTATGCCGCTTTCTTTGTCCCTCCCGGTGGGTCGGGTGGTGGCAGTGGAACTTATGCTAAAGATGCTCTTGGAAACGATGTTTTGGTAGATCAATGGCTCCAAACTCATGGACCTGGTGATAGAACTCTCACTCAGGGATTAAAGGGAGATCCTACTTATCTAGTTGTTGAGGCAGATAGATCTCTTGCAACATATGGCATCAATGCTGTGTGCACCCACCTTGGTTGTGTTGTCCCATGGAATTCGGCTGAGAACAAATTCATCTGTCCCTGCCACGGATCCCAGTATAACTACCAAGGCAAGGTTGTTAGAGGACCTGCCCCTTTGTCATTGGCATTGGCTCATGCGGATATAGACGATGGGAAGGTTTTATTTGTGCCCTGGCTAGAAACTGATTTCAGAACTGGTGAAGATCCCTGGTGGTCTTGAATTCTCTCTATAAACTCTTCTTCAGCAAAGACAAACAGCAGGAACAAATCTGAATGTTTGAATATTCTGTCTTTGAAGTAAAATAAAAAAAATAATAATAAAAAAAACATTCTTTTCGCCAAGTTCATGGTGTTGTATTATATCCGTGAAGAACAATGCTAGGAACTATGTTCAAATAATTTAAAAATTGGTAAAAAATGAATGTTCTGCTTGCAGCTGAAAAAAAAAAAA

Sequences View:[Contig0454](Contig Seguence)


Sequences View:[Contig0454](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
embCAM57108.1 Rieske iron-sulphur protein precursor Pinellia ternata226350 bits (899)9e-95169/227 (74%)186/227 (81%) +3

KEGG PathwayGO
Contig0454[1 Pathway]Contig0454[124 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
MetabolismEnergy Metabolism00195Photosynthesis[PATH:ath00195]Contig0454AT4G03280FEVCP

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT4G03280AT4G03280cytochrome b6f complexGO:0009512other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other cellular processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other metabolic processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767electron transport or energy pathways
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other cellular processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other metabolic processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767electron transport or energy pathways
AT4G03280AT4G03280"electron transporter, transferring electrons from cytochrome b6/f complex of photosystem II activity"GO:0046028other molecular functions
AT4G03280AT4G03280nonphotochemical quenchingGO:0010196response to abiotic or biotic stimulus
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280membraneGO:0016020other membranes
AT4G03280AT4G03280plasma membraneGO:0005886plasma membrane
AT4G03280AT4G03280thylakoidGO:0009579other intracellular components
AT4G03280AT4G03280thylakoidGO:0009579other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast envelopeGO:0009941plastid
AT4G03280AT4G03280chloroplast envelopeGO:0009941chloroplast
AT4G03280AT4G03280chloroplast envelopeGO:0009941other cytoplasmic components
AT4G03280AT4G03280chloroplast envelopeGO:0009941other intracellular components
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to stress
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to abiotic or biotic stimulus
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280membraneGO:0016020other membranes
AT4G03280AT4G03280plasma membraneGO:0005886plasma membrane
AT4G03280AT4G03280thylakoidGO:0009579other intracellular components
AT4G03280AT4G03280cytochrome b6f complexGO:0009512other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other cellular processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other metabolic processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767electron transport or energy pathways
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other cellular processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767other metabolic processes
AT4G03280AT4G03280photosynthetic electron transport chainGO:0009767electron transport or energy pathways
AT4G03280AT4G03280"electron transporter, transferring electrons from cytochrome b6/f complex of photosystem II activity"GO:0046028other molecular functions
AT4G03280AT4G03280nonphotochemical quenchingGO:0010196response to abiotic or biotic stimulus
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280membraneGO:0016020other membranes
AT4G03280AT4G03280plasma membraneGO:0005886plasma membrane
AT4G03280AT4G03280thylakoidGO:0009579other intracellular components
AT4G03280AT4G03280thylakoidGO:0009579other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast envelopeGO:0009941plastid
AT4G03280AT4G03280chloroplast envelopeGO:0009941chloroplast
AT4G03280AT4G03280chloroplast envelopeGO:0009941other cytoplasmic components
AT4G03280AT4G03280chloroplast envelopeGO:0009941other intracellular components
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to stress
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to abiotic or biotic stimulus
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280chloroplastGO:0009507chloroplast
AT4G03280AT4G03280membraneGO:0016020other membranes
AT4G03280AT4G03280plasma membraneGO:0005886plasma membrane
AT4G03280AT4G03280thylakoidGO:0009579other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast envelopeGO:0009941plastid
AT4G03280AT4G03280chloroplast envelopeGO:0009941chloroplast
AT4G03280AT4G03280chloroplast envelopeGO:0009941other cytoplasmic components
AT4G03280AT4G03280chloroplast envelopeGO:0009941other intracellular components
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to stress
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to abiotic or biotic stimulus
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535plastid
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535chloroplast
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other membranes
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other cytoplasmic components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast thylakoid membraneGO:0009535other intracellular components
AT4G03280AT4G03280chloroplast envelopeGO:0009941plastid
AT4G03280AT4G03280chloroplast envelopeGO:0009941chloroplast
AT4G03280AT4G03280chloroplast envelopeGO:0009941other cytoplasmic components
AT4G03280AT4G03280chloroplast envelopeGO:0009941other intracellular components
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to stress
AT4G03280AT4G03280defense response to bacteriumGO:0042742response to abiotic or biotic stimulus

Gene Network Informations
Gene NetworkInteract with..
Contig0454[interact with..]Not found!