Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FEICPContig31081233

Contig Map:
(ProjectName=FEICP
SequenceName=Contig3108):
GCAACTCCAATCTGAAATTAGGGTTTGTTTCTTTCGATGGAAGGAGAAGGGGGAACATTTCTTCACCCCGATGCAGCGTCTCCTCTTCCCGACCATCCTTCCAACCTAGGTTTATACAGCATAAAAAAGAGGCATTTTGGTTTTATAGGTTTCTCTCTATAGTCTATGATCACGTCATAAACCCTGGGCATTGGACTGAAGACATGAGGGATGAGGCCCTTGAGCCTGCAGATCTCTATGATTCCAGGATGAAGGTTGTGGATGTTGGAGGGGGAACTGGATTTACTACACTGGGAATTATTAAGCATATAAATCCAAAGAATGTCACCATTCTTGACCAGTCGCCACACCAGCTTGCCAAGGCCAGGCAAAAGGGAGCTTTGAAAGAGTGCACCATCATTGAAGGTGATGCAGAGGACTTGCCATTCCCGACGGACTCTGTTGATCGATATGTTTCTGCCGGAAGCATTGAGTACTGGCCAGATCCACAGCGTGGAATTGTGGAGGCATACCGTGTTCTAAAACTTGGAGGAGTAGCCTGCATAATTGGTCCTGTACACCCAACCTTTTGGCTTTCTCGCTTCTTTGCTGATATGTGGATGCTCTTCCCTAAGGAAGAAGAATATATTGAATGGTTTAAGAAAGCTGGGTTTAAAGATGTGAAGCTTAAAAGAATAGGTCCAAAATGGTATCGTGGTGTGAGACGCCATGGACTCATTATGGGATGCTCTGTCACCGGAGTTAAAAGAGAATCCGGTGAATCTCCTCTCAAGCTTGGTCCTAAGGTTGAGGCTGTGGAGAAATCTGTGAATCCATTTGCCTTTCTGGTTCGTTTCATTTTGGGTTCCATTGCTGCTGCTTACTACGTGCTGGTGCCTGTTTACATGTGGATTAAAGACCAGATAGTTCCAAAGGGAAAGCCAATTTGAATATGAAGAAGGCCATGATGATGATGTGAAAAAGGTGGGGAGAGAGAGACAGAGAGAGATGATGAACTATATTATCTGGTGTGAAGGATTGCATTAAACTAAAGAACTTTTGGTTGTACTTCTCCTAGCTATGCATTGTTAGATAACATTTGTATTTATAGACTTTCGCGCGCTTTGGATTTTAGCTCCATTTAATGTAATAATCTTTTGATGTTCTAATTTTTGAATTCATATCTATTCTCCTATTATTGAATGAGACATGTTCTCGATATCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
EICPM011_C10_pDNR-R:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGATATCGAGAACATGTCTCATTCAATAATAGGAGAATAGATATGAATTCAAAAATTAGAACATCAAAAGATTATTACATTAAATGGAGCTAAAATCCAAAGCGCGCGAAAGTCTATAAATACAAATGTTATCTAACAATGCATAGCTAGGAGAAGTACAACCAAAAGTTCTTTAGTTTAATGCAATCCTTCACACCAGATAATATAGTTCATCATCTCTCTCTGTCTCTCTCTCCCCACCTTTTTCACATCATCATCATGGCCTTCTTCATATTCAAATTGGCTTTCCCTTTGGAACTATCTGGTCTTTAATCCACATGTAAACAGGCACCAGCACGTAGTAAGCAGCAGCAATGGAACCCAAAATGAAACGAACCAGAAAGGCAAATGGATTCACAGATTTCTCCACAGCCTCAACCTTAGGACCAAGCTTGAGAGGAGATTCACCGGATTCTCTTTTAACTCCGGTGACAGAGCATCCCATAATGAGTCCATGGCGTCTCACACCACGATACCATTTTGGACCTATTCTTTTAAGCTTCACATCTTTAAACCCAGCTTTCTTAAACCATTCAATATATTCTTCTTCCTTAGGGAAGAGCATCCACATATCAGCAAAGAAGCGAGAAAGCCAAAAGGTTGGGTGTACAGGACCAATTATGCAGGCTACTCCTCCAAGTTTTAGAACACGGTATGCCTCCACAATTCCACGCTGTGGATCTGGCCAGTACTCAATGCTTCCGGCAGAAACATATCGATCAACAGAGTCCGTCGGGAATGGCAAGTCCTCTGCATCACCTTCAATGATGGTGCACTCTTTCAAAGCTCCCTTTTGCCTGGCCTTGGCAAGCTGGTGTGGCGACTGGTCAAGAATGGTGACATTCTTTGG
EICPM047_D01_pDNR-F:GCAACTCCAATCTGAAATTAGGGTTTGTTTCTTTCGATGGAAGGAGAAGGGGGAACATTTCTTCACCCCGATGCAGCGTCTCCTCTTCCCGACCATCCTTCCAACCTAGGTTTATACAGCATAAAAAAGAGGCATTTTGGTTTTATAGGTTTCTCTCTATAGTCTATGATCACGTCATAAACCCTGGGCATTGGACTGAAGACATGAGGGATGAGGCCCTTGAGCCTGCAGATCTCTATGATTCCAGGATGAAGGTTGTGGATGTTGGAGGGGGAACTGGATTTACTACACTGGGAATTATTAAGCATATAAATCCAAAGAATGTCACCATTCTTGACCAGTCGCCACACCAGCTTGCCAAGGCCAGGCAAAAGGGAGCTTTGAAAGAGTGCACCATCATTGAAGGTGATGCAGAGGACTTGCCATTCCCGACGGACTCTGTTGATCGATATGTTTCTGCCGGAAGCATTGAGTACTGGCCAGATCCACAGCGTGGAATTGTGGAGGCATACCGTGTTCTAAAACTTGGAGGAGTAGCCTGCATAATTGGTCCTGTACACCCAACCTTTTGGCTTTCTCGCTTCTTTGCTGATATGTGGATGCTCTTCCCTAAGGAAGAAGAATATATTGAATGGTTTAAGAAAGCTGGGTTTAAAGATGTGAAGCTTAAAAGAATAGGTCCAAAATGGTATCGTGGTGTGAGACGCCATGGACTCATTATGGGATGCTCTGTCACCGGAGTTAAAAGAGAATCCGGTGAATCTCCTCTCAAGCTTGGTCCTAAGGTTGAGGCTGTGGAGAAATCTGTGAATCCATTTGCCTTTCTGGTTCGTTTCATTTTGGGTTCCATTGCTGCTGCTTACTACGTGCTGGTGCCTGTTTACATGTGGATTAAAGACCAGATAGTTCCAAAGGGAAAGCCAATTTGAATATGAAGGCCATGATGATGATGTGAAAAAGGTGGGGAGAGAGACAGAGAGAGATGATGAACTATATTATCTGGTGTGAAGG

Sequences View:[Contig3108](Contig Seguence)


Sequences View:[EICPM011_C10_pDNR-R](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
refXP_002312559.1 predicted protein Populus trichocarpa341482 bits (1241)e-134225/272 (82%)243/272 (89%) +3

KEGG PathwayGO
Contig3108[1 Pathway]Contig3108[90 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
MetabolismMetabo lism of Cofactors and Vitamins00130Ubiquinone and other terpenoid-quinone biosynthesis[PATH:ath00130]Contig3108AT3G63410FEICP

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941plastid
AT3G63410AT3G63410chloroplast envelopeGO:0009941plastid
AT3G63410AT3G63410chloroplast envelopeGO:0009941chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941other cytoplasmic components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other cytoplasmic components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other intracellular components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other intracellular components
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410S-adenosylmethionine-dependent methyltransferase activityGO:0008757transferase activity
AT3G63410AT3G63410methyltransferase activityGO:0008168transferase activity
AT3G63410AT3G63410chloroplast inner membraneGO:0009706plastid
AT3G63410AT3G63410chloroplast inner membraneGO:0009706chloroplast
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other membranes
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other cytoplasmic components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other intracellular components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706plastid
AT3G63410AT3G63410chloroplast inner membraneGO:0009706chloroplast
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other membranes
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other cytoplasmic components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other intracellular components
AT3G63410AT3G63410vitamin E biosynthetic processGO:0010189other cellular processes
AT3G63410AT3G63410vitamin E biosynthetic processGO:0010189other metabolic processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other cellular processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other cellular processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other metabolic processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other metabolic processes
AT3G63410AT3G63410"2-methyl-6-phytyl-1,4-benzoquinone methyltransferase activity"GO:0051741transferase activity
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941plastid
AT3G63410AT3G63410chloroplast envelopeGO:0009941plastid
AT3G63410AT3G63410chloroplast envelopeGO:0009941chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941other cytoplasmic components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other cytoplasmic components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other intracellular components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other intracellular components
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410S-adenosylmethionine-dependent methyltransferase activityGO:0008757transferase activity
AT3G63410AT3G63410methyltransferase activityGO:0008168transferase activity
AT3G63410AT3G63410chloroplast inner membraneGO:0009706plastid
AT3G63410AT3G63410chloroplast inner membraneGO:0009706chloroplast
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other membranes
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other cytoplasmic components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other intracellular components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706plastid
AT3G63410AT3G63410chloroplast inner membraneGO:0009706chloroplast
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other membranes
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other cytoplasmic components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other intracellular components
AT3G63410AT3G63410vitamin E biosynthetic processGO:0010189other cellular processes
AT3G63410AT3G63410vitamin E biosynthetic processGO:0010189other metabolic processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other cellular processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other cellular processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other metabolic processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other metabolic processes
AT3G63410AT3G63410"2-methyl-6-phytyl-1,4-benzoquinone methyltransferase activity"GO:0051741transferase activity
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941plastid
AT3G63410AT3G63410chloroplast envelopeGO:0009941plastid
AT3G63410AT3G63410chloroplast envelopeGO:0009941chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941chloroplast
AT3G63410AT3G63410chloroplast envelopeGO:0009941other cytoplasmic components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other cytoplasmic components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other intracellular components
AT3G63410AT3G63410chloroplast envelopeGO:0009941other intracellular components
AT3G63410AT3G63410chloroplastGO:0009507chloroplast
AT3G63410AT3G63410S-adenosylmethionine-dependent methyltransferase activityGO:0008757transferase activity
AT3G63410AT3G63410methyltransferase activityGO:0008168transferase activity
AT3G63410AT3G63410chloroplast inner membraneGO:0009706plastid
AT3G63410AT3G63410chloroplast inner membraneGO:0009706chloroplast
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other membranes
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other cytoplasmic components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other intracellular components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706plastid
AT3G63410AT3G63410chloroplast inner membraneGO:0009706chloroplast
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other membranes
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other cytoplasmic components
AT3G63410AT3G63410chloroplast inner membraneGO:0009706other intracellular components
AT3G63410AT3G63410vitamin E biosynthetic processGO:0010189other cellular processes
AT3G63410AT3G63410vitamin E biosynthetic processGO:0010189other metabolic processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other cellular processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other cellular processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other metabolic processes
AT3G63410AT3G63410plastoquinone biosynthetic processGO:0010236other metabolic processes
AT3G63410AT3G63410"2-methyl-6-phytyl-1,4-benzoquinone methyltransferase activity"GO:0051741transferase activity

Gene Network Informations
Gene NetworkInteract with..
Contig3108[interact with..]Not found!