Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FCTEVCPContig0888870

Contig Map:
(ProjectName=FCTEVCP
SequenceName=Contig0888):
AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGCTGCCTCTGATCTTATCCGGATTTTCATCGAATTCGAGAGAGAACAAAAGGCGACTTGCATCGCCTGAGAGGTGAATCATCACTCGCCGGCGTAGACCTACACGAATCCTCGATTCCTGCTGCGCTGTGGCGTGCCGGTTGAGAGGATGTCAACTCCAGCGAGGAAGAGATTGATGAGGGACTTCAAACGATTGCAGCAGGACCCCCCTGCAGGCATTAGTGGCGCTCCTCAGGATAACAATATCATGCTGTGGAATGCTGTCATTTTTGGCCCTGATGACACTCCTTGGGATGGAGGTACGTTTAAGCTCACACTGCAGTTTACTGAGGATTATCCAAACAAGCCACCAACGGTTCGATTTGTTTCTCGAATGTTCCATCCAAATGTCTATGCAGATGGAAGTATTTGTTTGGATATTTTGCAGAATCAGTGGAGCCCCATCTATGATGTGGCTGCAATTCTTACGTCAATCCAGTCATTGCTCTGTGATCCAAATCCCAACTCCCCTGCCAACTCAGAAGCGGCTCGGATGTTCAGTGAAAACAAAAGGGAGTACAACAGGAGAGTTAGGGAGATTGTGGAGCAAAGCTGGACGGCAGACTGATGGCTCCCTTGCACAAGGAATTTCCGAAATTGTTATGTTCCCCTAAGAACTTTGCTGCTTTTACTACCAGTTGAAATGACTGAACCTTGCTAAATGTTTTTATTCGAAAACTGCTTCTAGTCTTGCAAGTCCTAGTTATGATGTGTTTTTGATTGCAAACATATTTTACTAGACATCAAAATCTCATCTCTTGAGATGGTTTGTCCCAAAAAAAAAAAAAAAAAA
FCTEVCPM028_D10_PDNR-F:AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGCTGCCTCTGATCTTATCCGGATTTTCATCGAATTCGAGAGAGAACAAAAGGCGACTTGCATCGCCTGAGAGGTGAATCATCACTCGCCGGCGTAGACCTACACGAATCCTCGATTCCTGCTGCGCTGTGGCGTGCCGGTTGAGAGGATGTCAACTCCAGCGAGGAAGAGATTGATGAGGGACTTCAAACGATTGCAGCAGGACCCCCCTGCAGGCATTAGTGGCGCTCCTCAGGATAACAATATCATGCTGTGGAATGCTGTCATTTTTGGCCCTGATGACACTCCTTGGGATGGAGGTACGTTTAAGCTCACACTGCAGTTTACTGAGGATTATCCAAACAAGCCACCAACGGTTCGATTTGTTTCTCGAATGTTCCATCCAAATGTCTATGCAGATGGAAGTATTTGTTTGGATATTTTGCAGAATCAGTGGAGCCCCATCTATGATGTGGCTGCAATTCTTACGTCAATCCAGTCATTGCTCTGTGATCCAAATCCCAACTCCCCTGCCAACTCAGAAGCGGCTCGGATGTTCAGTGAAAACAAAAGGGAGTACAACAGGAGAGTTAGGGAGATTGTGGAGCAAAGCTGGACGGCAGACTGATGGCTCCCTTGCACAAGGAATTTCCGAAATTGTTATGTTCCCCTAAGAACTTTGCTGCTTTTACTACCAGTTGAAATGACTGAACCTTGCTAAATGTTTTTATTCGAAAACTGCTTCTAGTCTTGCAAGTCCTAGTTATGATGTGTTTTTGATTGCAAACATATTTTACTAGACATCAAAATCTCATCTCTTGAGATGGTTTGTCCCAAAAAAAAAAAAAAAAAA
FCTEVCPM122_F06_PDNR-F:GGAGAACAAAAGGCGACTTGCATCGCCTGAGAGGTGAATCATCACTCGCCGGCGTAGACCTACACGAATCCTCGATTCCTGCTGCGCTGTGGCGTGCCGGTTGAGAGGATGTCAACTCCAGCGAGGAAGAGATTGATGAGGGACTTCAAACGATTGCAGCAGGACCCCCCTGCAGGCATTAGTGGCGCTCCTCAGGATAACAATATCATGCTGTGGAATGCTGTCATTTTTGGCCCTGATGACACTCCTTGGGATGGAGGTACGTTTAAGCTCACACTGCAGTTTACTGAGGATTATCCAAACAAGCCACCAACGGTTCGATTTGTTTCTCGAATGTTCCATCCAAATGTCTATGCAGATGGAAGTATTTGTTTGGATATTTTGCAGAATCAGTGGAGCCCCATCTATGATGTGGCTGCAATTCTTACGTCAATCCAGTCATTGCTCTGTGATCCAAATCCCAACTCCCCTGCCAACTCAGAAGCGGCTCGGATGTTCAGTGAAAACAAAAGGGAGTACAACAGGAGAGTTAGGGAGATTGTGGAGCAAAGCTGGACGGCAGACTGATGGCTCCCTTGCACAAGGAATTTCCGAAATTGTTATGTTCCCCTAAGAACTTTGCTGCTTTTACTACCAGTTGAAA

Sequences View:[Contig0888](Contig Seguence)


Sequences View:[Contig0888](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
gbAAF73016.1AF262934_1 ubiquitin conjugating protein Avicennia marina152319 bits (817)3e-85150/152 (98%)152/152 (100%) +1

KEGG PathwayGO
Contig0888[1 Pathway]Contig0888[15 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Genetic Information ProcessingFolding, Sorting and Degradation04120Ubiquitin mediated proteolysis[PATH:ath04120]Contig0888AT2G02760FCTEVCP

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT2G02760AT2G02760ubiquitin-protein ligase activityGO:0004842other enzyme activity
AT2G02760AT2G02760ubiquitin-protein ligase activityGO:0004842other enzyme activity
AT2G02760AT2G02760ubiquitin-protein ligase activityGO:0004842other enzyme activity
AT2G02760AT2G02760UV protectionGO:0009650response to abiotic or biotic stimulus
AT2G02760AT2G02760ubiquitin-dependent protein catabolic processGO:0006511protein metabolism
AT2G02760AT2G02760ubiquitin-dependent protein catabolic processGO:0006511other cellular processes
AT2G02760AT2G02760ubiquitin-dependent protein catabolic processGO:0006511other metabolic processes
AT2G02760AT2G02760ubiquitin-dependent protein catabolic processGO:0006511protein metabolism
AT2G02760AT2G02760ubiquitin-dependent protein catabolic processGO:0006511other cellular processes
AT2G02760AT2G02760ubiquitin-dependent protein catabolic processGO:0006511other metabolic processes
AT2G02760AT2G02760vegetative to reproductive phase transition of meristemGO:0010228developmental processes
AT2G02760AT2G02760histone H2B ubiquitinationGO:0033523protein metabolism
AT2G02760AT2G02760histone H2B ubiquitinationGO:0033523other cellular processes
AT2G02760AT2G02760histone H2B ubiquitinationGO:0033523other metabolic processes
AT2G02760AT2G02760histone H2B ubiquitinationGO:0033523cell organization and biogenesis

Gene Network Informations
Gene NetworkInteract with..
Contig0888[interact with..]Contig0888
Contig0743
Contig0206
Contig1472
FCTEVCPM097_E02_PDNR-F
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
Contig0888870gbAAF73016.1AF262934_1 ubiquitin conjugating protein Avicennia marina152319 bits (817)3e-85150/152 (98%)152/152 (100%) +1
Contig0743370gbAAY29571.1 immature spike ubiquitin-conjugating enzyme 2 Triticum aestivum14884.7 bits (208)3e-1537/38 (97%)38/38 (100%) +2
Contig02061014gbABI84264.1 ubiquitin-conjugating enzyme Arachis hypogaea166135 bits (340)2e-6264/85 (75%)68/85 (80%) +1
Contig1472941gbABI84264.1 ubiquitin-conjugating enzyme Arachis hypogaea166260 bits (664)2e-67119/147 (80%)129/147 (87%) +1
FCTEVCPM097_E02_PDNR-F1047gbABI84264.1 ubiquitin-conjugating enzyme Arachis hypogaea166267 bits (683)1e-69123/149 (82%)132/149 (88%) +3