Back [Phalaenopsis Transcriptome]
Library Name:       Contig Lists:     
Contig Information:
Project NameQuery NameLength of query
FCTEVCPContig04911056

Contig Map:
(ProjectName=FCTEVCP
SequenceName=Contig0491):
GGTTTCCCAACCCACCACTCTTGATTGCCTCTCCTTGCGGTTGCCATCCTCCGTCTCCGGTGATACCCCGACCCCTCCATCCCAAAATGAATGACGCTGATGTCTCGCGGCAGATCCAGCAGATGGTGCGGTTCATCCGCCAGGAGGCCGAGGAAAAGGCGAACGAGATCTCCGTCTCCGCAGAAGAGGAATTTAACATTGAGAAGCTGCAACTAGTTGAGGCAGAAAAAAAGGAAGATTAGACAAGAATATGAACGCAAACAGAAGCAAGTTGAAGTTCGAAGGAAAATTGAGTATTCAATGCAGCTTAATGCTTCTCGTATTAAAGTTCTTCAAGGTCAAGATAAACTGGTCAATTCAATGAAGGAGGCTGCTACAAAGGAGATTCTGAATGTTGCCCATCATCATCATACATATAAACATCTCCTGAGAGATTTGATTGTTCAGGGCTTGCTTCGACTGAAGGAACCAGCTGTATTGTTACGTTGTCGAGAGGAGGATCTTGAGTTTGTGGATGCTGTTCTGAATGAAGCGAAGCATGAATATGCAGAAAAAGCTGGCGTCCATCCTCCTGAGATCATTGTTGATAATGATGTGTATCTACCATCTTCTCGTAGTCATCACGATACTCATGGGCAATTTTGCTCTGGTGGGGTTGTGCTGGCGTCTCGAGATGGGAAGATAGTTTGTGAGAACACACTTGACGCAAGGCTCGAGGTTGTCTTCCGGAAAAAGCTACCGGAGATCCGGAAGCTCCTCTTTAGCGAGGCGTAAGGCCACTGATGGTTCCAAAACTCTTCATATTCTCCCTTTTTGTTGGCTTTCCTGTTATCCAGTACCTGAGTTTTACTGTCTCTATTTGATGTGTTGTTACTTATAAGTTCATATTCTACACTGTGTATGTGTTTGTTTTATTTGTTGAAATACAATAATAATCACAACTGTATTACTGCGTGAAACATTATTGTACTCGTATTGCTCCCCTCGTGATTCCTCTAAACAAAGCCAAAGTTTTTATCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
FCTEVCPM090_H04_PDNR-F:GGTTTCCCAACCCACCACTCTTGATTGCCTCTCCTTGCGGTTGCCATCCTCCGTCTCCGGTGATACCCCGACCCCTCCATCCCAAAATGAATGACGCTGATGTCTCGCGGCAGATCCAGCAGATGGTGCGGTTCATCCGCCAGGAGGCCGAGGAAAAGGCGAACGAGATCTCCGTCTCCGCAGAAGAGGAATTTAACATTGAGAAGCTGCAACTAGTTGAGGCAGAAAAAAGGAAGATTAGACAAGAATATGAACGCAAACAGAAGCAAGTTGAAGTTCGAAGGAAAATTGAGTATTCAATGCAGCTTAATGCTTCTCGTATTAAAGTTCTTCAAGGTCAAGATAAACTGGTCAATTCAATGAAGGAGGCTGCTACAAAGGAGATTCTGAATGTTGCCCATCATCATCATACATATAAACATCTCCTGAGAGATTTGATTGTTCAGGGCTTGCTTCGACTGAAGGAACCAGCTGTATTGTTACGTTGTCGAGAGGAGGATCTTGAGTTTGTGGATGCTGTTCTGAATGAAGCGAAGCATGAATATGCAGAAAAAGCTGGCGTCCATCCTCCTGAGATCATTGTTGATAATGATGTGTATCTACCATCTTCTCGTAGTCATCACGATACTCATGGGCAATTTTGCTCTGGTGGGGTTGTGCTGGCGTCTCGAGATGGGAAGATAGTTTTTGAGAACACACTTGACGCAAGGCTCGAGGTTGTCTTCCGGAAAAAGCTACCGGAGATCCGGAAGCTCCTCTTTAGCGAGGCGTAAGGCCACTGATGGTTCCAAAACTCTTCATATTCTCCCTTTTTGTTGGCTTTCCTGTTATCCAGTACCTGAGTTTTACTGTCTCTATTTGATGTGTTGTTACTTATAAGTTCGTATTCTACACTGTGTATGTGTTGTTTATTTGTTGAAATACAATAATAATCACAACTGTATTACTGCGTGAAACATTATTGTACTCGTATTGCGAAAAAAA
FCTEVCPM039_C03_PDNR-F:GGTTTCCCAACCCACCACTCTTGATTGCCTCTCCTTGCGGTTGCCATCCTCCGTCTCCGGTGATACCCCGACCCCTCCATCCCAAAATGAATGACGCTGATGTCTCGCGGCAGATCCAGCAGATGGTGCGGTTCATCCGCCAGGAGGCCGAGGAAAAGGCGAACGAGATCTCCGTCTCCGCAGAAGAGGAATTTAACATTGAGAAGCTGCAACTAGTTGAGGCAGAAAAAAAGGAAGATTAGACAAGAATATGAACGCAAACAGAAGCAAGTTGAGGTTCGAAGGAAAATTGAGTATTCAATGCAGCTTAATGCTTCTCGTATTAAAGTTCTTCAAGGTCAAGATAAACTCGTCAATTCAATGAAGGAGGCTGCTACAAAGGAGATTCTGAATGTTGCCCATCATCATCATACATATAAACATCTCCTGAGAGATTTGATTGTTCAGGGCTTGCTTCGACTGAAGGAACCAGCTGTATTGTTACGTTGTCGAGAGGAGGATCTTGAGTTTGTGGATGCTGTTCTGAATGAAGCGAAGCATGAATATGCAGAAAAAGCTGGCGTCCATCCTCCTGAGATCATTGTTGATAATGATGTGTATCTACCATCTTCTCGTAGTCATCACGATACTCATGGGCAATTTTGCTCTGGTGGGGTTGTGCTGGCGTCTCGAGATGGGAAGATAGTTTGTGAGAACACACTTGACGCAAGGCTCGAGGTTGTCTTCCGGAAAAAGCTACCGGAGATCCGGAAGCTCCTCTTTAGCGAGGCGTAAGGCCACTGATGGTTCCAAAACTCTTCATATTCTCCCTTTTTGTTGGCTTTCCTGTTATCCAGTACCTGAGTTTTACTGTCTCTATTTGATGTGTTGTTACTTATAAGTTCATATTCTACACTGTGTATGTGTTTGTTTTATTTGTTGAAATACAATAATAATCACAACTGTATTACTGCGTGAAACATTATTGTACTCGTATTGCTCCCCTCGTGATTCTCTAAACA
FCTEVCPM121_F03_PDNR-F:GGTTTCCCAACCCACCACTCTTGATTGCCTCTCCTTGCGGTTGCCATCCTCCGTCTCCGGTGATACCCCGACCCCTCCATCCCAAAATGAATGACGCTGATGTCTCGCGGCAGATCCAGCAGATGGTGCGGTTCATCCGCCAGGAGGCCGAGGAAAAGGCGAACGAGATCTCCGTCTCCGCAGAAGAGGAATTTAACATTGAGAAGCTGCAACTAGTTGAGGCAGAAAAAAGGAAGATTAGACAAGAATATGAACGCAAACAGAAGCAAGTTGAAGTTCGAAGGAAAATTGAGTATTCAATGCAGCTTAATGCTTCTCGTATTAAAGTTCTTCAAGGTCAAGATAAACTGGTCAATTCAATGAAGGAGGCTGCTACAAAGGAGATTCTGAATGTTGCCCATCATCATCATACATATAAACATCTCCTGAGAGATTTGATTGTTCAGGGCTTGCTTCGACTGAAGGAACCAGCTGTATTGTTACGTTGTCGAGAGGAGGATCTTGAGTTTGTGGATGCTGTTCTGAATGAAGCGAAGCATGAATATGCAGAAAAAGCTGGCGTCCATCCTCCTGAGATCATTGTTGATAATGATGTGTATCTACCATCTTCTCGTAGTCATCACGATACTCATGGGCAATTTTGCTCTGGTGGGGTTGTGCTGGCGTCTCGAGATGGGAAGATAGTTTGTGAGAACACACTTGACGCAAGGCTCGAGGTTGTCTTCCGGAAAAAGCTACCGGAGATCCGGAAGCTCCTCTTTAGCGAGGCGTAAGGCCACTGATGGTTCCAAAACTCTTCATATTCTCCCTTTTTGTTGGCTTTCCTGTTATCCAGTACCTGAGTTTTACTGTCTCTATTTGATGTGTTGTTACTTATAAGTTCATATTCTACACTGTGTATGTGTTTGTTTATTTGTGAAATACATAATAATCACAACTGTATTACTGCGTGAAACATTATTGTACTCGTATTGCTCGAAAAAAAAAAAAAAAAAAAAAAA
FCTEVCPM033_B07_PDNR-F:GGTTTCCCAACCCACCACTCTTGATTGCCTCTCCTTGCGGTTGCCATCCTCCGTCTCCGGTGATACCCCGACCCCTCCATCCCAAAATGAATGACGCTGATGTCTCGCGGCAGATCCAGCAGATGGTGCGGTTCATCCGCCAGGAGGCCGAGGAAAAGGCGAACGAGATCTCCGTCTCCGCAGAAGAGGAATTTAACATTGAGAAGCTGCAACTAGTTGAGGCAGAAAAAAGGAAGATTAGACAAGAATATGAACGCAAACAGAAGCAAGTTGAAGTTCGAAGGAAAATTGAGTATTCAATGCAGCTTAATGCTTCTCGTATTAAAGTTCTTCAAGGTCAAGATAAACTGGTCAATTCAATGAAGGAGGCTGCTACAAAGGAGATTCTGAATGTTGCCCATCATCATCATACATATAAACATCTCCTGAGAGATTTGATTGCTCAGGGCTTGCTTCGACTGAAGGAACCAGCTGTATTGTTACGTTGTCGAGAGGAGGATCTTGAGTTTGTGGATGCTGTTCTGAATGAAGCGAAGCATGAATATGCAGAAAAAGCTGGCGTCCATCCTCCTGAGATCATTGTTGATAATGATGTGTATCTACCATCTTCTCGTAGTCATCACGATACTCATGGGCAATTTTGCTCTGGTGGGGTTGTGCTGGCGTCTCGAGATGGGAAGATAGTTTGTGAGAACACACTTGACGCAAGGCTCGAGGTTGTCTTCCGGAAAAAGCTACCGGAGATCCGGAAGCTCCTCTTTAGCGAGGCGTAAGGCCACTGATGGTTCCAAAACTCTTCATATTCTCCCTTTTTGTTGGCTTTCCTGTTATCCAGTACCTGAGTTTTACTGTCTCTATTTGATGTGTTGTTACTTATAAGTTCATATTCTACACTGTGTATGTGTTTGTTTTATTTGTTGAAATACAATAATAATCACAACTGTATTACTGCGTGAAACATTATTGTACTCGTATTGCTCCCCTCGTGATTCCTCTAAACAAAGCCAAAGTTTTTATCTTGAAAA

Sequences View:[Contig0491](Contig Seguence)


Sequences View:[Contig0491](Singleton Sequence)

Contig Annotation:
GenBankAccession number
(Best hits in the GenBank)
AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
refXP_002509910.1 vacuolar ATP synthase subunit E, putative Ricinus communis230282 bits (722)1e-95137/181 (75%)161/181 (88%) +1

KEGG PathwayGO
Contig0491[2 Pathway]Contig0491[57 GoTerm]
Pathway Informations
First-level termsSecond-level termsKEGG pathway NumKEGG pathway NameKEGG pathway Description contig NamelocusNameproject Name
Cellular ProcessesTransport and Catabolism04145Phagosome[PATH:ath04145]Contig0491AT1G64200FCTEVCP
MetabolismEnergy Metabolism00190Oxidative phosphorylation[PATH:ath00190]Contig0491AT1G64200FCTEVCP

GO Informations
Locus NameGo NameGo Class DescriptionsGO idAnotations01
AT1G64200AT1G64200plasma membraneGO:0005886plasma membrane
AT1G64200AT1G64200vacuoleGO:0005773other cytoplasmic components
AT1G64200AT1G64200vacuoleGO:0005773other cytoplasmic components
AT1G64200AT1G64200vacuoleGO:0005773other intracellular components
AT1G64200AT1G64200vacuoleGO:0005773other intracellular components
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986transport
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other cellular processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other metabolic processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986electron transport or energy pathways
AT1G64200AT1G64200"proton-transporting ATPase activity, rotational mechanism"GO:0046961hydrolase activity
AT1G64200AT1G64200"proton-transporting ATPase activity, rotational mechanism"GO:0046961transporter activity
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753mitochondria
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other membranes
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other cytoplasmic components
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other intracellular components
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986transport
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other cellular processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other metabolic processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986electron transport or energy pathways
AT1G64200AT1G64200plasma membraneGO:0005886plasma membrane
AT1G64200AT1G64200vacuoleGO:0005773other cytoplasmic components
AT1G64200AT1G64200vacuoleGO:0005773other cytoplasmic components
AT1G64200AT1G64200vacuoleGO:0005773other intracellular components
AT1G64200AT1G64200vacuoleGO:0005773other intracellular components
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986transport
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other cellular processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other metabolic processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986electron transport or energy pathways
AT1G64200AT1G64200"proton-transporting ATPase activity, rotational mechanism"GO:0046961hydrolase activity
AT1G64200AT1G64200"proton-transporting ATPase activity, rotational mechanism"GO:0046961transporter activity
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753mitochondria
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other membranes
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other cytoplasmic components
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other intracellular components
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986transport
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other cellular processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other metabolic processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986electron transport or energy pathways
AT1G64200AT1G64200plasma membraneGO:0005886plasma membrane
AT1G64200AT1G64200vacuoleGO:0005773other cytoplasmic components
AT1G64200AT1G64200vacuoleGO:0005773other cytoplasmic components
AT1G64200AT1G64200vacuoleGO:0005773other intracellular components
AT1G64200AT1G64200vacuoleGO:0005773other intracellular components
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986transport
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other cellular processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other metabolic processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986electron transport or energy pathways
AT1G64200AT1G64200"proton-transporting ATPase activity, rotational mechanism"GO:0046961hydrolase activity
AT1G64200AT1G64200"proton-transporting ATPase activity, rotational mechanism"GO:0046961transporter activity
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753mitochondria
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other membranes
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other cytoplasmic components
AT1G64200AT1G64200mitochondrial proton-transporting ATP synthase complexGO:0005753other intracellular components
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986transport
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other cellular processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986other metabolic processes
AT1G64200AT1G64200ATP synthesis coupled proton transportGO:0015986electron transport or energy pathways

Gene Network Informations
Gene NetworkInteract with..
Contig0491[interact with..]Contig0491
Query NameLength of queryGenBankAccession number(Best hits in the GenBank)AnnotationSpeciesLength of homologous protein(Amino Acid)ScoreExpect valueIdentitiessimilarityFrame
Contig04911056refXP_002509910.1 vacuolar ATP synthase subunit E, putative Ricinus communis230282 bits (722)1e-95137/181 (75%)161/181 (88%) +1